Incidental Mutation 'R7369:Tgm4'
ID 572010
Institutional Source Beutler Lab
Gene Symbol Tgm4
Ensembl Gene ENSMUSG00000025787
Gene Name transglutaminase 4 (prostate)
Synonyms Eapa1, 9530008N10Rik, experimental autoimmune prostatitis antigen 1
MMRRC Submission 045453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R7369 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 122863806-122896623 bp(+) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 122885749 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026893] [ENSMUST00000215247] [ENSMUST00000217607]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000026893
SMART Domains Protein: ENSMUSP00000026893
Gene: ENSMUSG00000025787

DomainStartEndE-ValueType
Pfam:Transglut_N 8 118 4e-26 PFAM
TGc 247 340 6.25e-42 SMART
Pfam:Transglut_C 573 670 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215247
Predicted Effect probably benign
Transcript: ENSMUST00000217607
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired copulatory plug formation, reduced fertilization and few litters sired. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020L13Rik C T 7: 29,989,377 (GRCm39) L196F unknown Het
Ahr A T 12: 35,554,659 (GRCm39) W487R possibly damaging Het
Apaf1 A G 10: 90,836,898 (GRCm39) S1060P probably damaging Het
Atf7 G T 15: 102,462,244 (GRCm39) P126H probably damaging Het
B3gnt5 C A 16: 19,588,410 (GRCm39) Q210K probably benign Het
Begain T C 12: 108,999,853 (GRCm39) Y306C possibly damaging Het
Car5a T C 8: 122,650,573 (GRCm39) K157R probably benign Het
Car5b A C X: 162,797,836 (GRCm39) S35R probably benign Het
Cdh6 A G 15: 13,042,724 (GRCm39) V478A probably damaging Het
Cdyl A G 13: 35,999,992 (GRCm39) E91G probably damaging Het
Cep135 A C 5: 76,741,100 (GRCm39) K59Q possibly damaging Het
Clec2m T A 6: 129,308,496 (GRCm39) Q11L possibly damaging Het
Cnot3 T A 7: 3,656,330 (GRCm39) D205E possibly damaging Het
Dgkd G A 1: 87,849,344 (GRCm39) G379R probably damaging Het
Dppa1 T A 11: 46,506,944 (GRCm39) probably null Het
Dsp G T 13: 38,381,501 (GRCm39) V2749F possibly damaging Het
E2f4 A G 8: 106,026,966 (GRCm39) K177E probably benign Het
Efcab5 G A 11: 77,008,661 (GRCm39) P819L possibly damaging Het
Ercc5 T A 1: 44,220,020 (GRCm39) S1097R probably benign Het
Erp44 T C 4: 48,218,183 (GRCm39) N162S probably benign Het
Evl A G 12: 108,652,824 (GRCm39) Y423C unknown Het
Fam78a T A 2: 31,959,699 (GRCm39) N137I probably damaging Het
Fcrl2 T C 3: 87,164,008 (GRCm39) N374D possibly damaging Het
Fcrla T G 1: 170,749,886 (GRCm39) D57A probably benign Het
Gm7145 A T 1: 117,913,838 (GRCm39) H240L probably benign Het
Kdm5a T A 6: 120,408,965 (GRCm39) N1549K possibly damaging Het
Kirrel1 C T 3: 87,048,391 (GRCm39) R9H probably benign Het
Klf7 T C 1: 64,160,300 (GRCm39) probably null Het
Lce1d G A 3: 92,593,390 (GRCm39) Q8* probably null Het
Lcn4 T C 2: 26,557,906 (GRCm39) H180R probably benign Het
Lmntd1 T A 6: 145,359,301 (GRCm39) Y283F probably damaging Het
Lrp1b C T 2: 41,172,051 (GRCm39) R1646K Het
Map3k21 C A 8: 126,637,855 (GRCm39) A147E possibly damaging Het
Mapk8ip2 T C 15: 89,338,454 (GRCm39) S11P probably benign Het
Mdn1 T A 4: 32,773,375 (GRCm39) F5518L probably damaging Het
Msh3 T A 13: 92,435,770 (GRCm39) T510S probably benign Het
Myh1 A T 11: 67,111,524 (GRCm39) Q1654H probably damaging Het
Ncbp3 T C 11: 72,968,747 (GRCm39) V506A probably benign Het
Nfkbiz A G 16: 55,642,209 (GRCm39) S70P probably damaging Het
Nmi T C 2: 51,840,096 (GRCm39) D215G possibly damaging Het
Nphp3 T C 9: 103,895,449 (GRCm39) S496P probably damaging Het
Nrp1 T A 8: 129,158,396 (GRCm39) C228S probably damaging Het
Or6c5c A T 10: 129,299,390 (GRCm39) M282L probably benign Het
Pcdh9 C A 14: 94,123,803 (GRCm39) R789L possibly damaging Het
Pigr A T 1: 130,769,503 (GRCm39) T105S probably benign Het
Polr2a A C 11: 69,636,803 (GRCm39) S383A probably benign Het
Prr35 G A 17: 26,166,934 (GRCm39) S201L probably damaging Het
Psd3 T A 8: 68,356,818 (GRCm39) H634L possibly damaging Het
Ptgr2 T G 12: 84,339,080 (GRCm39) probably benign Het
Ptk6 A G 2: 180,840,254 (GRCm39) Y251H possibly damaging Het
Rnf213 A G 11: 119,321,294 (GRCm39) T1251A Het
Rtkn2 A G 10: 67,877,259 (GRCm39) K443E probably damaging Het
Rundc3a T A 11: 102,290,721 (GRCm39) L268Q probably damaging Het
Serpinb5 A G 1: 106,802,879 (GRCm39) E138G probably benign Het
Shroom1 A T 11: 53,356,075 (GRCm39) D375V probably benign Het
Siglecf A G 7: 43,001,241 (GRCm39) T70A probably damaging Het
Slc20a2 A T 8: 23,051,416 (GRCm39) E483V probably benign Het
Slc49a3 A G 5: 108,593,394 (GRCm39) V148A probably benign Het
Sort1 G A 3: 108,258,996 (GRCm39) G676D probably damaging Het
Spef2 T C 15: 9,584,293 (GRCm39) S1581G probably benign Het
Stx6 C T 1: 155,073,130 (GRCm39) R214* probably null Het
Stxbp5l A G 16: 36,954,703 (GRCm39) I950T probably benign Het
Tdrd7 T A 4: 46,013,239 (GRCm39) C660S possibly damaging Het
Tmem67 T C 4: 12,053,535 (GRCm39) Y671C probably damaging Het
Ttc6 A T 12: 57,719,717 (GRCm39) probably null Het
Tut7 A G 13: 59,929,867 (GRCm39) I1458T possibly damaging Het
Uba2 A G 7: 33,850,239 (GRCm39) S405P possibly damaging Het
Usp34 T C 11: 23,382,361 (GRCm39) I2043T Het
Vmn1r12 T A 6: 57,136,683 (GRCm39) I260N possibly damaging Het
Vmn1r172 C T 7: 23,360,030 (GRCm39) T305I unknown Het
Vmn2r24 T C 6: 123,792,638 (GRCm39) V655A probably damaging Het
Wdr33 T C 18: 32,019,719 (GRCm39) S464P probably benign Het
Zfp260 T A 7: 29,804,750 (GRCm39) C217S probably damaging Het
Zfp760 A G 17: 21,942,214 (GRCm39) E463G probably benign Het
Zhx1 A G 15: 57,916,696 (GRCm39) Y517H probably damaging Het
Other mutations in Tgm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Tgm4 APN 9 122,891,447 (GRCm39) unclassified probably benign
IGL01402:Tgm4 APN 9 122,880,519 (GRCm39) missense possibly damaging 0.82
IGL02000:Tgm4 APN 9 122,885,531 (GRCm39) missense probably damaging 1.00
IGL02120:Tgm4 APN 9 122,875,594 (GRCm39) missense probably damaging 0.98
IGL03130:Tgm4 APN 9 122,885,580 (GRCm39) missense probably damaging 1.00
IGL03188:Tgm4 APN 9 122,874,101 (GRCm39) missense probably null 0.06
R0329:Tgm4 UTSW 9 122,877,622 (GRCm39) critical splice donor site probably null
R0480:Tgm4 UTSW 9 122,891,484 (GRCm39) missense probably benign
R0644:Tgm4 UTSW 9 122,880,523 (GRCm39) missense probably damaging 1.00
R0990:Tgm4 UTSW 9 122,875,576 (GRCm39) missense probably benign 0.02
R1604:Tgm4 UTSW 9 122,874,129 (GRCm39) missense probably benign 0.39
R1644:Tgm4 UTSW 9 122,880,481 (GRCm39) missense probably damaging 1.00
R2056:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2058:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2059:Tgm4 UTSW 9 122,890,835 (GRCm39) missense probably damaging 1.00
R2076:Tgm4 UTSW 9 122,880,160 (GRCm39) missense probably benign 0.24
R2437:Tgm4 UTSW 9 122,877,614 (GRCm39) nonsense probably null
R4392:Tgm4 UTSW 9 122,895,817 (GRCm39) missense probably benign 0.10
R4407:Tgm4 UTSW 9 122,885,595 (GRCm39) missense probably damaging 1.00
R4752:Tgm4 UTSW 9 122,880,451 (GRCm39) missense probably damaging 1.00
R5288:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5365:Tgm4 UTSW 9 122,895,866 (GRCm39) missense probably damaging 1.00
R5386:Tgm4 UTSW 9 122,885,559 (GRCm39) missense probably damaging 1.00
R5790:Tgm4 UTSW 9 122,890,808 (GRCm39) missense probably damaging 0.98
R5890:Tgm4 UTSW 9 122,890,703 (GRCm39) missense probably damaging 1.00
R6102:Tgm4 UTSW 9 122,885,600 (GRCm39) missense probably benign
R6358:Tgm4 UTSW 9 122,885,583 (GRCm39) missense probably damaging 1.00
R6956:Tgm4 UTSW 9 122,893,768 (GRCm39) missense possibly damaging 0.93
R6966:Tgm4 UTSW 9 122,880,207 (GRCm39) missense possibly damaging 0.68
R7091:Tgm4 UTSW 9 122,869,525 (GRCm39) missense probably damaging 1.00
R7258:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7313:Tgm4 UTSW 9 122,891,556 (GRCm39) missense probably benign 0.02
R7802:Tgm4 UTSW 9 122,880,401 (GRCm39) intron probably benign
R8219:Tgm4 UTSW 9 122,874,117 (GRCm39) missense probably benign
R8787:Tgm4 UTSW 9 122,890,910 (GRCm39) missense probably damaging 1.00
R8936:Tgm4 UTSW 9 122,869,541 (GRCm39) missense possibly damaging 0.92
R9045:Tgm4 UTSW 9 122,877,616 (GRCm39) missense possibly damaging 0.94
R9328:Tgm4 UTSW 9 122,885,697 (GRCm39) missense possibly damaging 0.93
R9359:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9403:Tgm4 UTSW 9 122,881,837 (GRCm39) missense probably damaging 1.00
R9471:Tgm4 UTSW 9 122,869,444 (GRCm39) missense probably benign
R9746:Tgm4 UTSW 9 122,875,634 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CACTGACTGCTATTCGCCAG -3'
(R):5'- CATTCTTGCTAAAGACCATGTGG -3'

Sequencing Primer
(F):5'- ATTCGCCAGGGATTGATCC -3'
(R):5'- GTTGGGTTGTTGTGACAGGGAC -3'
Posted On 2019-09-13