Incidental Mutation 'R7369:Msh3'
ID572030
Institutional Source Beutler Lab
Gene Symbol Msh3
Ensembl Gene ENSMUSG00000014850
Gene NamemutS homolog 3
SynonymsRep3, Rep-3, D13Em1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location92211872-92355003 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 92299262 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 510 (T510S)
Ref Sequence ENSEMBL: ENSMUSP00000140002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022220] [ENSMUST00000185852] [ENSMUST00000187874] [ENSMUST00000191550]
Predicted Effect
SMART Domains Protein: ENSMUSP00000022220
Gene: ENSMUSG00000014850
AA Change: T510S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 1.6e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185852
AA Change: T510S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000140002
Gene: ENSMUSG00000014850
AA Change: T510S

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:MutS_I 188 301 7.2e-35 PFAM
Pfam:MutS_II 324 481 2.2e-36 PFAM
MUTSd 513 828 7.62e-97 SMART
MUTSac 847 1049 9.7e-122 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187874
SMART Domains Protein: ENSMUSP00000139620
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191550
SMART Domains Protein: ENSMUSP00000140659
Gene: ENSMUSG00000014850

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a heterodimer with MSH2 to form MutS beta, part of the post-replicative DNA mismatch repair system. MutS beta initiates mismatch repair by binding to a mismatch and then forming a complex with MutL alpha heterodimer. This gene contains a polymorphic 9 bp tandem repeat sequence in the first exon. The repeat is present 6 times in the reference genome sequence and 3-7 repeats have been reported. Defects in this gene are a cause of susceptibility to endometrial cancer. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a partial defect mismatch repair and development of intestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Msh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Msh3 APN 13 92344964 missense probably damaging 1.00
IGL00983:Msh3 APN 13 92300277 missense probably damaging 1.00
IGL01490:Msh3 APN 13 92300305 missense probably damaging 1.00
IGL02072:Msh3 APN 13 92300295 missense probably damaging 1.00
IGL02313:Msh3 APN 13 92349312 missense possibly damaging 0.86
IGL02711:Msh3 APN 13 92351311 missense probably damaging 1.00
IGL03108:Msh3 APN 13 92221088 splice site probably benign
IGL03227:Msh3 APN 13 92285960 missense probably damaging 0.98
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0164:Msh3 UTSW 13 92349209 missense probably damaging 1.00
R0415:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
R0457:Msh3 UTSW 13 92220997 missense probably damaging 1.00
R0659:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0661:Msh3 UTSW 13 92345096 missense possibly damaging 0.80
R0686:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0688:Msh3 UTSW 13 92351431 missense possibly damaging 0.53
R0707:Msh3 UTSW 13 92347340 nonsense probably null
R1605:Msh3 UTSW 13 92300275 missense probably null 1.00
R1622:Msh3 UTSW 13 92344954 critical splice donor site probably null
R1771:Msh3 UTSW 13 92212496 missense probably benign 0.05
R1970:Msh3 UTSW 13 92249820 splice site probably benign
R1971:Msh3 UTSW 13 92223276 missense probably damaging 1.00
R1971:Msh3 UTSW 13 92249820 splice site probably benign
R2894:Msh3 UTSW 13 92342360 missense probably benign 0.16
R3837:Msh3 UTSW 13 92354858 missense probably damaging 1.00
R4119:Msh3 UTSW 13 92354011 intron probably benign
R4225:Msh3 UTSW 13 92285923 missense probably benign 0.03
R4881:Msh3 UTSW 13 92266041 intron probably benign
R5118:Msh3 UTSW 13 92309434 splice site probably benign
R5209:Msh3 UTSW 13 92344954 critical splice donor site probably null
R5817:Msh3 UTSW 13 92286000 missense possibly damaging 0.86
R5849:Msh3 UTSW 13 92249878 missense possibly damaging 0.81
R5851:Msh3 UTSW 13 92215522 missense probably benign 0.00
R5940:Msh3 UTSW 13 92249843 missense probably damaging 1.00
R6004:Msh3 UTSW 13 92342414 critical splice acceptor site probably null
R6363:Msh3 UTSW 13 92212524 missense probably damaging 1.00
R6510:Msh3 UTSW 13 92353264 nonsense probably null
R6654:Msh3 UTSW 13 92345042 missense probably benign 0.01
R6853:Msh3 UTSW 13 92312572 critical splice donor site probably null
R7022:Msh3 UTSW 13 92235588 missense probably damaging 1.00
R7098:Msh3 UTSW 13 92274111 missense possibly damaging 0.95
R7103:Msh3 UTSW 13 92274800 missense probably benign
R7148:Msh3 UTSW 13 92354822 missense probably benign 0.18
R7171:Msh3 UTSW 13 92349298 missense probably benign 0.00
R7317:Msh3 UTSW 13 92286004 missense probably damaging 1.00
R7586:Msh3 UTSW 13 92349332 utr 3 prime probably benign
R7641:Msh3 UTSW 13 92212503 missense probably benign 0.08
R7648:Msh3 UTSW 13 92274028 missense probably damaging 1.00
R7674:Msh3 UTSW 13 92212503 missense probably benign 0.08
R8125:Msh3 UTSW 13 92299182 missense probably benign
S24628:Msh3 UTSW 13 92346786 missense possibly damaging 0.89
X0027:Msh3 UTSW 13 92274070 missense probably damaging 0.98
X0063:Msh3 UTSW 13 92274785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTGATCTAATTAGCCATGGCAAC -3'
(R):5'- AACACGTTATTTGGGCATGTG -3'

Sequencing Primer
(F):5'- GGCAACATTAGTTTTAAAGAAGCG -3'
(R):5'- GCATGTGTATTGTTTAAATCAGGC -3'
Posted On2019-09-13