Incidental Mutation 'R7369:Cdh6'
ID572033
Institutional Source Beutler Lab
Gene Symbol Cdh6
Ensembl Gene ENSMUSG00000039385
Gene Namecadherin 6
Synonymscad6, K-cadherin
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.573) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location13028701-13173675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13042638 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 478 (V478A)
Ref Sequence ENSEMBL: ENSMUSP00000037113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036439]
PDB Structure
Crystal structure of cadherin-6 EC12 W4A [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036439
AA Change: V478A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000037113
Gene: ENSMUSG00000039385
AA Change: V478A

DomainStartEndE-ValueType
CA 76 157 7e-15 SMART
CA 181 266 9.06e-32 SMART
CA 290 382 1.14e-19 SMART
CA 405 486 8.81e-21 SMART
CA 509 596 2.82e-10 SMART
transmembrane domain 614 636 N/A INTRINSIC
Pfam:Cadherin_C 639 783 5.6e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Mice lacking the encoded protein exhibit delay in mesenchyme-to-epithelial conversion and a loss of nephrons. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 15. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit delayed mesenchyme to epithelial conversion and loss of nephrons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
B3gnt5 C A 16: 19,769,660 Q210K probably benign Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in Cdh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Cdh6 APN 15 13034359 nonsense probably null
IGL00675:Cdh6 APN 15 13041439 missense possibly damaging 0.80
IGL01063:Cdh6 APN 15 13064495 missense probably damaging 1.00
IGL01335:Cdh6 APN 15 13051309 missense probably benign 0.40
IGL01351:Cdh6 APN 15 13034240 missense possibly damaging 0.55
IGL02010:Cdh6 APN 15 13034190 utr 3 prime probably benign
IGL02428:Cdh6 APN 15 13064430 missense possibly damaging 0.94
PIT4651001:Cdh6 UTSW 15 13044719 missense possibly damaging 0.69
R0124:Cdh6 UTSW 15 13034324 missense probably damaging 1.00
R0256:Cdh6 UTSW 15 13053782 splice site probably benign
R0696:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R1017:Cdh6 UTSW 15 13051476 missense probably benign 0.06
R1240:Cdh6 UTSW 15 13057455 missense possibly damaging 0.48
R1444:Cdh6 UTSW 15 13091838 missense probably benign 0.00
R2008:Cdh6 UTSW 15 13051476 missense possibly damaging 0.74
R2050:Cdh6 UTSW 15 13057501 missense probably benign
R2507:Cdh6 UTSW 15 13041361 missense probably benign 0.10
R3082:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3083:Cdh6 UTSW 15 13044752 missense probably damaging 1.00
R3903:Cdh6 UTSW 15 13042575 missense probably benign 0.39
R4591:Cdh6 UTSW 15 13051486 missense possibly damaging 0.69
R4859:Cdh6 UTSW 15 13051332 missense probably benign 0.36
R4898:Cdh6 UTSW 15 13034688 missense probably damaging 0.99
R5242:Cdh6 UTSW 15 13064411 missense probably benign 0.05
R5313:Cdh6 UTSW 15 13034637 missense probably damaging 1.00
R5545:Cdh6 UTSW 15 13041149 missense probably damaging 1.00
R6360:Cdh6 UTSW 15 13041460 missense possibly damaging 0.82
R6650:Cdh6 UTSW 15 13051401 missense probably benign 0.11
R6830:Cdh6 UTSW 15 13044774 missense probably benign 0.01
R7506:Cdh6 UTSW 15 13034310 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGCAAAGACCTCTCAG -3'
(R):5'- AAGAGCTCCTAAGTCCTGCC -3'

Sequencing Primer
(F):5'- CCTTGGAGACTGATGAACTTCCAG -3'
(R):5'- GACCAGAAGTCCGTCCTCCAG -3'
Posted On2019-09-13