Incidental Mutation 'R7369:B3gnt5'
ID572037
Institutional Source Beutler Lab
Gene Symbol B3gnt5
Ensembl Gene ENSMUSG00000022686
Gene NameUDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 5
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R7369 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location19760208-19772753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19769660 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 210 (Q210K)
Ref Sequence ENSEMBL: ENSMUSP00000078712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079780] [ENSMUST00000119468] [ENSMUST00000121344] [ENSMUST00000164397]
Predicted Effect probably benign
Transcript: ENSMUST00000079780
AA Change: Q210K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000078712
Gene: ENSMUSG00000022686
AA Change: Q210K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119468
AA Change: Q210K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000113145
Gene: ENSMUSG00000022686
AA Change: Q210K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121344
AA Change: Q210K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000112624
Gene: ENSMUSG00000022686
AA Change: Q210K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164397
AA Change: Q210K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000126157
Gene: ENSMUSG00000022686
AA Change: Q210K

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Pfam:Galactosyl_T 100 299 2e-49 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-1,3-N-acetylglucosaminyltransferase family. This enzyme is a type II membrane protein. It exhibits strong activity to transfer GlcNAc to glycolipid substrates and is identified as the most likely candidate for lactotriaosylceramide synthase. This enzyme is essential for the expression of Lewis X epitopes on glycolipids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice may show variable types of lethality or no lethality depending on the allele. Mice homozygous for 3 alleles show B cell abnormalities. Mice homozygous or heterozygous for 2 allele show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4922502D21Rik T A 6: 129,331,533 Q11L possibly damaging Het
A930017K11Rik G A 17: 25,947,960 S201L probably damaging Het
Ahr A T 12: 35,504,660 W487R possibly damaging Het
Apaf1 A G 10: 91,001,036 S1060P probably damaging Het
Atf7 G T 15: 102,553,809 P126H probably damaging Het
Begain T C 12: 109,033,927 Y306C possibly damaging Het
Car5a T C 8: 121,923,834 K157R probably benign Het
Car5b A C X: 164,014,840 S35R probably benign Het
Cdh6 A G 15: 13,042,638 V478A probably damaging Het
Cdyl A G 13: 35,816,009 E91G probably damaging Het
Cep135 A C 5: 76,593,253 K59Q possibly damaging Het
Cnot3 T A 7: 3,653,331 D205E possibly damaging Het
Dgkd G A 1: 87,921,622 G379R probably damaging Het
Dppa1 T A 11: 46,616,117 probably null Het
Dsp G T 13: 38,197,525 V2749F possibly damaging Het
E2f4 A G 8: 105,300,334 K177E probably benign Het
Efcab5 G A 11: 77,117,835 P819L possibly damaging Het
Ercc5 T A 1: 44,180,860 S1097R probably benign Het
Erp44 T C 4: 48,218,183 N162S probably benign Het
Evl A G 12: 108,686,565 Y423C unknown Het
Fam78a T A 2: 32,069,687 N137I probably damaging Het
Fcrla T G 1: 170,922,317 D57A probably benign Het
Fcrls T C 3: 87,256,701 N374D possibly damaging Het
Gm7145 A T 1: 117,986,108 H240L probably benign Het
Kdm5a T A 6: 120,432,004 N1549K possibly damaging Het
Kirrel C T 3: 87,141,084 R9H probably benign Het
Klf7 T C 1: 64,121,141 probably null Het
Lce1d G A 3: 92,686,083 Q8* probably null Het
Lcn4 T C 2: 26,667,894 H180R probably benign Het
Lmntd1 T A 6: 145,413,575 Y283F probably damaging Het
Lrp1b C T 2: 41,282,039 R1646K Het
Map3k21 C A 8: 125,911,116 A147E possibly damaging Het
Mapk8ip2 T C 15: 89,454,251 S11P probably benign Het
Mdn1 T A 4: 32,773,375 F5518L probably damaging Het
Mfsd7a A G 5: 108,445,528 V148A probably benign Het
Msh3 T A 13: 92,299,262 T510S probably benign Het
Myh1 A T 11: 67,220,698 Q1654H probably damaging Het
Ncbp3 T C 11: 73,077,921 V506A probably benign Het
Nfkbiz A G 16: 55,821,846 S70P probably damaging Het
Nmi T C 2: 51,950,084 D215G possibly damaging Het
Nphp3 T C 9: 104,018,250 S496P probably damaging Het
Nrp1 T A 8: 128,431,915 C228S probably damaging Het
Olfr787 A T 10: 129,463,521 M282L probably benign Het
Pcdh9 C A 14: 93,886,367 R789L possibly damaging Het
Pigr A T 1: 130,841,766 T105S probably benign Het
Polr2a A C 11: 69,745,977 S383A probably benign Het
Psd3 T A 8: 67,904,166 H634L possibly damaging Het
Ptgr2 T G 12: 84,292,306 probably benign Het
Ptk6 A G 2: 181,198,461 Y251H possibly damaging Het
Rnf213 A G 11: 119,430,468 T1251A Het
Rtkn2 A G 10: 68,041,429 K443E probably damaging Het
Rundc3a T A 11: 102,399,895 L268Q probably damaging Het
Serpinb5 A G 1: 106,875,149 E138G probably benign Het
Shroom1 A T 11: 53,465,248 D375V probably benign Het
Siglecf A G 7: 43,351,817 T70A probably damaging Het
Slc20a2 A T 8: 22,561,400 E483V probably benign Het
Sort1 G A 3: 108,351,680 G676D probably damaging Het
Spef2 T C 15: 9,584,207 S1581G probably benign Het
Stx6 C T 1: 155,197,384 R214* probably null Het
Stxbp5l A G 16: 37,134,341 I950T probably benign Het
Tdrd7 T A 4: 46,013,239 C660S possibly damaging Het
Tgm4 T A 9: 123,056,684 probably null Het
Thap8 C T 7: 30,289,952 L196F unknown Het
Tmem67 T C 4: 12,053,535 Y671C probably damaging Het
Ttc6 A T 12: 57,672,931 probably null Het
Uba2 A G 7: 34,150,814 S405P possibly damaging Het
Usp34 T C 11: 23,432,361 I2043T Het
Vmn1r12 T A 6: 57,159,698 I260N possibly damaging Het
Vmn1r172 C T 7: 23,660,605 T305I unknown Het
Vmn2r24 T C 6: 123,815,679 V655A probably damaging Het
Wdr33 T C 18: 31,886,666 S464P probably benign Het
Zcchc6 A G 13: 59,782,053 I1458T possibly damaging Het
Zfp260 T A 7: 30,105,325 C217S probably damaging Het
Zfp760 A G 17: 21,723,233 E463G probably benign Het
Zhx1 A G 15: 58,053,300 Y517H probably damaging Het
Other mutations in B3gnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:B3gnt5 APN 16 19769213 missense probably damaging 1.00
IGL01503:B3gnt5 APN 16 19769781 missense probably damaging 1.00
IGL02623:B3gnt5 APN 16 19769610 missense probably damaging 1.00
IGL02978:B3gnt5 APN 16 19769994 missense probably damaging 1.00
IGL03355:B3gnt5 APN 16 19769153 missense probably benign 0.01
IGL03388:B3gnt5 APN 16 19770051 missense possibly damaging 0.83
R0180:B3gnt5 UTSW 16 19769100 missense possibly damaging 0.48
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0973:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R0974:B3gnt5 UTSW 16 19770010 missense probably damaging 1.00
R1034:B3gnt5 UTSW 16 19769484 missense probably damaging 1.00
R1435:B3gnt5 UTSW 16 19769174 missense probably damaging 0.99
R1480:B3gnt5 UTSW 16 19769867 missense probably damaging 1.00
R1533:B3gnt5 UTSW 16 19769614 missense probably damaging 1.00
R1920:B3gnt5 UTSW 16 19769544 missense probably benign 0.34
R3962:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R3963:B3gnt5 UTSW 16 19769048 missense probably benign 0.37
R4620:B3gnt5 UTSW 16 19769882 missense probably benign 0.37
R4948:B3gnt5 UTSW 16 19769144 missense probably benign
R4987:B3gnt5 UTSW 16 19769202 missense probably damaging 1.00
R5027:B3gnt5 UTSW 16 19769694 missense probably damaging 1.00
R6415:B3gnt5 UTSW 16 19770009 missense probably damaging 1.00
R7027:B3gnt5 UTSW 16 19769990 missense probably damaging 1.00
R7224:B3gnt5 UTSW 16 19769753 missense probably benign 0.06
R7261:B3gnt5 UTSW 16 19769373 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTCCTGGTCCACTGAAGG -3'
(R):5'- AGATTTTGGCAGCTACATCTCTG -3'

Sequencing Primer
(F):5'- CTCCTGGTCCACTGAAGGGAAAAG -3'
(R):5'- TTGGCAGCTACATCTCTGGAGAC -3'
Posted On2019-09-13