Incidental Mutation 'R7371:Upf2'
ID572051
Institutional Source Beutler Lab
Gene Symbol Upf2
Ensembl Gene ENSMUSG00000043241
Gene NameUPF2 regulator of nonsense transcripts homolog (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location5951469-6056703 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5961040 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 157 (E157G)
Ref Sequence ENSEMBL: ENSMUSP00000058375 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060092]
Predicted Effect unknown
Transcript: ENSMUST00000060092
AA Change: E157G
SMART Domains Protein: ENSMUSP00000058375
Gene: ENSMUSG00000043241
AA Change: E157G

DomainStartEndE-ValueType
low complexity region 12 23 N/A INTRINSIC
low complexity region 54 125 N/A INTRINSIC
MIF4G 167 363 1.22e-32 SMART
coiled coil region 514 543 N/A INTRINSIC
MIF4G 567 756 1.13e-50 SMART
MIF4G 771 984 3.43e-50 SMART
low complexity region 1023 1042 N/A INTRINSIC
Pfam:Upf2 1051 1215 1.5e-45 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of a post-splicing multiprotein complex involved in both mRNA nuclear export and mRNA surveillance. mRNA surveillance detects exported mRNAs with truncated open reading frames and initiates nonsense-mediated mRNA decay (NMD). When translation ends upstream from the last exon-exon junction, this triggers NMD to degrade mRNAs containing premature stop codons. This protein is located in the perinuclear area. It interacts with translation release factors and the proteins that are functional homologs of yeast Upf1p and Upf3p. Two splice variants have been found for this gene; both variants encode the same protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Upf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Upf2 APN 2 5961300 missense unknown
IGL01394:Upf2 APN 2 6040213 splice site probably null
IGL01571:Upf2 APN 2 6018939 unclassified probably benign
IGL01624:Upf2 APN 2 6034179 missense probably benign
IGL02121:Upf2 APN 2 6026323 splice site probably benign
IGL02485:Upf2 APN 2 6027291 missense unknown
IGL02491:Upf2 APN 2 6026164 missense unknown
R0265:Upf2 UTSW 2 6027204 splice site probably benign
R0390:Upf2 UTSW 2 6018894 unclassified probably benign
R0480:Upf2 UTSW 2 5957634 missense possibly damaging 0.71
R0513:Upf2 UTSW 2 5957667 missense unknown
R0579:Upf2 UTSW 2 5988429 missense unknown
R0612:Upf2 UTSW 2 6034098 splice site probably benign
R0856:Upf2 UTSW 2 5957652 missense unknown
R1103:Upf2 UTSW 2 6026175 missense unknown
R1384:Upf2 UTSW 2 5960989 missense unknown
R1672:Upf2 UTSW 2 6040097 splice site probably null
R1728:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1784:Upf2 UTSW 2 6027450 missense probably damaging 1.00
R1836:Upf2 UTSW 2 6050324 splice site probably null
R2252:Upf2 UTSW 2 5961460 missense unknown
R2339:Upf2 UTSW 2 6040102 splice site probably benign
R3015:Upf2 UTSW 2 5976079 missense unknown
R3931:Upf2 UTSW 2 6047010 missense unknown
R4151:Upf2 UTSW 2 5961705 missense unknown
R4283:Upf2 UTSW 2 5973558 missense unknown
R4558:Upf2 UTSW 2 5973593 missense unknown
R4564:Upf2 UTSW 2 6027312 missense unknown
R5630:Upf2 UTSW 2 6027301 missense probably damaging 0.99
R6370:Upf2 UTSW 2 5976010 missense unknown
R6418:Upf2 UTSW 2 6027339 missense unknown
R6432:Upf2 UTSW 2 5979777 missense unknown
R7184:Upf2 UTSW 2 6023320 missense unknown
R7308:Upf2 UTSW 2 5973518 missense unknown
R7404:Upf2 UTSW 2 6040203 missense unknown
R7439:Upf2 UTSW 2 6018932 missense unknown
R7441:Upf2 UTSW 2 6018932 missense unknown
R7461:Upf2 UTSW 2 5973536 missense unknown
R7483:Upf2 UTSW 2 6027408 missense unknown
R7613:Upf2 UTSW 2 5973536 missense unknown
R7976:Upf2 UTSW 2 6026115 missense unknown
R8044:Upf2 UTSW 2 6029438 missense unknown
Z1176:Upf2 UTSW 2 6023388 missense unknown
Predicted Primers PCR Primer
(F):5'- AGGTTGTGCAAGACCCCAAG -3'
(R):5'- CAGCACAGTTCACGTCAGAGAG -3'

Sequencing Primer
(F):5'- AACAAGCAGTGGAGGCTGTTTTTG -3'
(R):5'- CACGTCAGAGAGTTTTAATTTTGCC -3'
Posted On2019-09-13