Incidental Mutation 'R7371:Pde4dip'
ID572063
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97757271 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 425 (E425G)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045243] [ENSMUST00000090750] [ENSMUST00000107038] [ENSMUST00000168438] [ENSMUST00000175751]
Predicted Effect probably damaging
Transcript: ENSMUST00000045243
AA Change: E468G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000040905
Gene: ENSMUSG00000038170
AA Change: E468G

DomainStartEndE-ValueType
low complexity region 72 90 N/A INTRINSIC
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
SCOP:d1gw5a_ 613 839 3e-3 SMART
coiled coil region 909 985 N/A INTRINSIC
low complexity region 1081 1099 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090750
AA Change: E425G

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: E425G

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107038
AA Change: E371G

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000102653
Gene: ENSMUSG00000038170
AA Change: E371G

DomainStartEndE-ValueType
Pfam:Microtub_assoc 70 144 7.8e-32 PFAM
low complexity region 150 165 N/A INTRINSIC
coiled coil region 228 271 N/A INTRINSIC
internal_repeat_1 343 384 5.54e-5 PROSPERO
low complexity region 513 524 N/A INTRINSIC
internal_repeat_1 566 607 5.54e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000168438
AA Change: E425G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: E425G

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175751
AA Change: E468G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134832
Gene: ENSMUSG00000038170
AA Change: E468G

DomainStartEndE-ValueType
Pfam:zf-AD 4 78 4.3e-8 PFAM
low complexity region 159 170 N/A INTRINSIC
coiled coil region 399 451 N/A INTRINSIC
coiled coil region 513 538 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7014:Pde4dip UTSW 3 97715422 missense possibly damaging 0.54
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTCTGAGCTCTGAAAAGAGG -3'
(R):5'- CTGGTGACGTAGATAAGTGCTC -3'

Sequencing Primer
(F):5'- CTCTGAGCTCTGAAAAGAGGAGAATC -3'
(R):5'- AGATGTCACTATTGTCAGGCCAGC -3'
Posted On2019-09-13