Incidental Mutation 'R7371:Cyp2u1'
ID572064
Institutional Source Beutler Lab
Gene Symbol Cyp2u1
Ensembl Gene ENSMUSG00000027983
Gene Namecytochrome P450, family 2, subfamily u, polypeptide 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location131288441-131303227 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131293495 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 479 (N479I)
Ref Sequence ENSEMBL: ENSMUSP00000142519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106337] [ENSMUST00000200236]
Predicted Effect probably benign
Transcript: ENSMUST00000106337
SMART Domains Protein: ENSMUSP00000101944
Gene: ENSMUSG00000027983

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 527 4.2e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200236
AA Change: N479I

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142519
Gene: ENSMUSG00000027983
AA Change: N479I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:p450 69 473 1.1e-108 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This enzyme is a hydroxylase that metabolizes arachidonic acid, docosahexaenoic acid, and other long chain fatty acids. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Cyp2u1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02027:Cyp2u1 APN 3 131297951 missense probably damaging 1.00
IGL02365:Cyp2u1 APN 3 131298229 missense probably damaging 1.00
R0387:Cyp2u1 UTSW 3 131295552 splice site probably null
R0781:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1110:Cyp2u1 UTSW 3 131293609 missense possibly damaging 0.85
R1620:Cyp2u1 UTSW 3 131302701 missense probably damaging 0.98
R3087:Cyp2u1 UTSW 3 131303027 missense probably benign
R3845:Cyp2u1 UTSW 3 131293486 missense possibly damaging 0.66
R4996:Cyp2u1 UTSW 3 131298284 missense probably benign 0.00
R5913:Cyp2u1 UTSW 3 131303211 unclassified probably benign
R6815:Cyp2u1 UTSW 3 131298010 missense probably damaging 1.00
R6903:Cyp2u1 UTSW 3 131302775 missense probably benign 0.03
R6932:Cyp2u1 UTSW 3 131298296 missense possibly damaging 0.94
R7067:Cyp2u1 UTSW 3 131293553 missense probably damaging 1.00
R7167:Cyp2u1 UTSW 3 131303124 missense probably benign 0.23
R7193:Cyp2u1 UTSW 3 131291143 missense probably benign
R7262:Cyp2u1 UTSW 3 131297956 missense probably damaging 1.00
R7488:Cyp2u1 UTSW 3 131297947 missense probably damaging 1.00
R7605:Cyp2u1 UTSW 3 131297953 missense probably damaging 0.99
R7733:Cyp2u1 UTSW 3 131303027 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- AAGTCACTGCTGTCCATAGC -3'
(R):5'- ATTCCCAAAGGCACAGTGGTC -3'

Sequencing Primer
(F):5'- ACTGCTGTCCATAGCCATGC -3'
(R):5'- ACAGTGGTCCTAATCAACCTGTGG -3'
Posted On2019-09-13