Incidental Mutation 'R7371:Col24a1'
ID572065
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Namecollagen, type XXIV, alpha 1
Synonyms5430404K19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145292472-145552011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145343698 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 629 (N629S)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848]
Predicted Effect probably benign
Transcript: ENSMUST00000029848
AA Change: N629S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: N629S

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145545316 splice site probably benign
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R1969:Col24a1 UTSW 3 145314930 missense probably benign 0.03
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R4972:Col24a1 UTSW 3 145509684 missense probably benign 0.42
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145315025 nonsense probably null
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145486304 nonsense probably null
R7315:Col24a1 UTSW 3 145431870 missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 145293165 critical splice donor site probably null
R7383:Col24a1 UTSW 3 145298838 missense probably benign
R7605:Col24a1 UTSW 3 145538687 missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145314453 missense probably benign 0.00
R7679:Col24a1 UTSW 3 145399355 missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145315011 missense probably benign
R7701:Col24a1 UTSW 3 145366901 splice site probably null
R7805:Col24a1 UTSW 3 145314140 missense probably benign 0.02
R7913:Col24a1 UTSW 3 145431866 nonsense probably null
R7994:Col24a1 UTSW 3 145431866 nonsense probably null
R8056:Col24a1 UTSW 3 145314164 missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145507702 missense probably benign 0.31
R8294:Col24a1 UTSW 3 145481089 missense probably null 1.00
R8305:Col24a1 UTSW 3 145474182 missense probably benign 0.00
Z1176:Col24a1 UTSW 3 145342498 missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145342499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAATGCCTTTTGGGTTCTGAAGTTC -3'
(R):5'- TAGACACAGCCTTGATGGGAC -3'

Sequencing Primer
(F):5'- TGGGTTCTGAAGTTCCAAAAATC -3'
(R):5'- CTCCTGTGCACCAAGGGAAAATG -3'
Posted On2019-09-13