Mutagenetix > Incidental Mutation

Incidental Mutation 'R0646:Mast4'

57207

Institutional Source

Beutler Lab

Gene Symbol

Mast4

Ensembl Gene

ENSMUSG00000034751

Gene Name

microtubule associated serine/threonine kinase family member 4

Synonyms

4930420O11Rik

MMRRC Submission

038831-MU

Accession Numbers

Genbank: NM_175171.3; EnsemblENSMUST00000167058 , ENSMUST00000167462, ENSMUST00000166726, ENSMUST00000164111 , ENSMUST00000166336, ENSMUST00000099202, ENSMUST00000172264, ENSMUST00000171791, ENSMUST00000091273

Essential gene?

Possibly non essential (E-score: 0.398) question?

Stock #

R0646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

102732486-103334497 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to C at 102758744 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099202] [ENSMUST00000166726] [ENSMUST00000167058] [ENSMUST00000167462] [ENSMUST00000171791] [ENSMUST00000172264]

AlphaFold

Q811L6

Predicted Effect

probably benign
Transcript: ENSMUST00000099202

SMART Domains

Protein: ENSMUSP00000096808
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	13	38	N/A	INTRINSIC
Pfam:DUF1908	76	353	2.2e-146	PFAM
S_TKc	391	664	4.13e-98	SMART
S_TK_X	665	729	3.79e-2	SMART
low complexity region	745	758	N/A	INTRINSIC
low complexity region	818	831	N/A	INTRINSIC
low complexity region	840	857	N/A	INTRINSIC
low complexity region	925	960	N/A	INTRINSIC
PDZ	970	1050	2.34e-15	SMART
low complexity region	1070	1087	N/A	INTRINSIC
low complexity region	1111	1122	N/A	INTRINSIC
low complexity region	1127	1139	N/A	INTRINSIC
low complexity region	1142	1164	N/A	INTRINSIC
low complexity region	1202	1219	N/A	INTRINSIC
low complexity region	1290	1306	N/A	INTRINSIC
low complexity region	1345	1361	N/A	INTRINSIC
low complexity region	1937	1953	N/A	INTRINSIC
low complexity region	1996	2010	N/A	INTRINSIC
low complexity region	2150	2161	N/A	INTRINSIC
low complexity region	2296	2307	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000166726

SMART Domains

Protein: ENSMUSP00000132263
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	530	4.2e-145	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1035	1070	N/A	INTRINSIC
PDZ	1080	1160	2.34e-15	SMART
low complexity region	1180	1201	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167058

SMART Domains

Protein: ENSMUSP00000128464
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
low complexity region	23	51	N/A	INTRINSIC
Pfam:DUF1908	256	529	5.1e-134	PFAM
S_TKc	568	841	4.13e-98	SMART
S_TK_X	842	906	3.79e-2	SMART
low complexity region	922	935	N/A	INTRINSIC
low complexity region	995	1008	N/A	INTRINSIC
low complexity region	1017	1034	N/A	INTRINSIC
low complexity region	1102	1137	N/A	INTRINSIC
PDZ	1147	1227	2.34e-15	SMART
low complexity region	1247	1264	N/A	INTRINSIC
low complexity region	1288	1299	N/A	INTRINSIC
low complexity region	1304	1316	N/A	INTRINSIC
low complexity region	1319	1341	N/A	INTRINSIC
low complexity region	1379	1396	N/A	INTRINSIC
low complexity region	1467	1483	N/A	INTRINSIC
low complexity region	1522	1538	N/A	INTRINSIC
low complexity region	2114	2130	N/A	INTRINSIC
low complexity region	2173	2187	N/A	INTRINSIC
low complexity region	2327	2338	N/A	INTRINSIC
low complexity region	2473	2484	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167462

SMART Domains

Protein: ENSMUSP00000131910
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	3e-145	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	843	878	N/A	INTRINSIC
PDZ	888	968	2.34e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167834

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170645

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000171722

Predicted Effect

probably benign
Transcript: ENSMUST00000171791

SMART Domains

Protein: ENSMUSP00000131651
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	64	338	1.2e-144	PFAM
S_TKc	376	649	4.13e-98	SMART
S_TK_X	650	714	3.79e-2	SMART
low complexity region	730	743	N/A	INTRINSIC
low complexity region	803	816	N/A	INTRINSIC
low complexity region	825	842	N/A	INTRINSIC
low complexity region	910	945	N/A	INTRINSIC
PDZ	955	1035	2.34e-15	SMART
low complexity region	1055	1072	N/A	INTRINSIC
low complexity region	1096	1107	N/A	INTRINSIC
low complexity region	1112	1124	N/A	INTRINSIC
low complexity region	1127	1149	N/A	INTRINSIC
low complexity region	1187	1204	N/A	INTRINSIC
low complexity region	1275	1291	N/A	INTRINSIC
low complexity region	1330	1346	N/A	INTRINSIC
low complexity region	1922	1938	N/A	INTRINSIC
low complexity region	1981	1995	N/A	INTRINSIC
low complexity region	2135	2146	N/A	INTRINSIC
low complexity region	2281	2292	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172264

SMART Domains

Protein: ENSMUSP00000128129
Gene: ENSMUSG00000034751

Domain	Start	End	E-Value	Type
Pfam:DUF1908	49	326	4.1e-147	PFAM
S_TKc	364	637	4.13e-98	SMART
S_TK_X	638	702	3.79e-2	SMART
low complexity region	718	731	N/A	INTRINSIC
low complexity region	791	804	N/A	INTRINSIC
low complexity region	813	830	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000194446

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (123/130)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the microtubule-associated serine/threonine protein kinases. The proteins in this family contain a domain that gives the kinase the ability to determine its own scaffold to control the effects of their kinase activities. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit malocclusion. [provided by MGI curators]

Allele List at MGI

All alleles(8) : Gene trapped(8)

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	C	T	11: 23,575,491	R716H	probably damaging	Het
4930432E11Rik	C	T	7: 29,561,285		noncoding transcript	Het
A430078G23Rik	T	C	8: 3,386,959	Y250H	probably damaging	Het
Abcb11	A	G	2: 69,285,283	I579T	probably damaging	Het
Abcc9	T	C	6: 142,682,104	N400S	probably benign	Het
Adarb2	T	C	13: 8,731,819	L577P	probably damaging	Het
Agt	A	C	8: 124,557,113	N422K	probably damaging	Het
Ahnak	A	T	19: 9,013,402	K4017*	probably null	Het
Akap13	C	A	7: 75,747,746	Q2575K	probably damaging	Het
Aldh3a2	A	T	11: 61,253,715	I339K	probably damaging	Het
Alox15	G	T	11: 70,345,624	Y483*	probably null	Het
Ampd1	A	T	3: 103,099,597	I713F	probably damaging	Het
Amph	A	T	13: 19,113,116	E344V	possibly damaging	Het
Arid5b	A	G	10: 68,096,977	S1032P	probably damaging	Het
Armc8	C	A	9: 99,505,688	L393F	probably damaging	Het
Bpnt1	A	G	1: 185,345,426		probably null	Het
Cachd1	G	A	4: 100,988,221	R970H	probably damaging	Het
Cd207	T	C	6: 83,675,756	T131A	probably benign	Het
Cd83	G	A	13: 43,797,533	V54I	probably benign	Het
Cfap43	T	C	19: 47,763,676	K1086E	probably benign	Het
Cfap65	A	T	1: 74,902,169	V1837E	probably benign	Het
Clcnka	T	A	4: 141,396,606	H89L	probably benign	Het
Cnga4	T	C	7: 105,404,975	I50T	possibly damaging	Het
Cog5	A	G	12: 31,837,359		probably benign	Het
Col11a2	T	A	17: 34,059,348		probably null	Het
Col28a1	T	G	6: 8,175,291	I186L	possibly damaging	Het
Col4a2	T	A	8: 11,431,252	M808K	probably benign	Het
Copb2	A	G	9: 98,563,475		probably benign	Het
Dbnl	G	A	11: 5,795,441		probably benign	Het
Dbx2	T	C	15: 95,654,612	T51A	possibly damaging	Het
Dcp1a	A	T	14: 30,502,885	M123L	probably damaging	Het
Ddx42	T	A	11: 106,232,833	F217I	probably benign	Het
Dlc1	T	C	8: 36,858,051	T367A	probably benign	Het
Dmgdh	A	T	13: 93,752,355	T834S	probably benign	Het
Dnah8	T	C	17: 30,684,173	S929P	probably damaging	Het
Dnase1l2	C	A	17: 24,441,082	V271L	possibly damaging	Het
Dsc1	T	C	18: 20,096,057	Y392C	probably damaging	Het
Edn1	T	C	13: 42,305,242		probably benign	Het
Eps8l3	T	C	3: 107,884,810	L351P	probably damaging	Het
F12	G	A	13: 55,422,483		probably benign	Het
Fam47e	T	C	5: 92,578,458		probably benign	Het
Fcrl5	C	A	3: 87,442,013	Q32K	probably benign	Het
Fndc1	C	T	17: 7,741,673	V1637I	possibly damaging	Het
Foxg1	G	T	12: 49,384,567		probably benign	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Galnt5	A	T	2: 57,999,085	K232N	probably benign	Het
Ggt5	G	A	10: 75,602,648	V68M	probably damaging	Het
Gm11639	G	A	11: 104,720,501	D390N	probably benign	Het
Gm13084	A	C	4: 143,812,585	S113A	possibly damaging	Het
Gm16519	T	C	17: 70,929,106	C17R	probably benign	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gm884	T	A	11: 103,613,160	K485*	probably null	Het
Gm9631	T	G	11: 121,945,629	D28A	probably damaging	Het
Gpx2	T	C	12: 76,795,313	I21M	probably benign	Het
H2-Q2	T	G	17: 35,345,685	D354E	probably damaging	Het
Icam2	A	T	11: 106,380,891	I71K	probably damaging	Het
Il12a	T	C	3: 68,697,890		probably benign	Het
Insm2	C	G	12: 55,600,440	A323G	probably benign	Het
Itga1	T	C	13: 114,968,299	T1064A	probably benign	Het
Itgad	T	A	7: 128,174,004	V11E	possibly damaging	Het
Kctd15	C	T	7: 34,644,881	S115N	probably damaging	Het
Klra5	A	G	6: 129,903,564	W124R	probably damaging	Het
Kng2	T	A	16: 22,987,736	D571V	probably benign	Het
Kpna6	A	T	4: 129,650,790	F380I	probably benign	Het
Lipo1	A	T	19: 33,784,769	Y109*	probably null	Het
Man2a2	T	C	7: 80,363,197	H540R	possibly damaging	Het
Map2k4	T	C	11: 65,712,275	E188G	probably damaging	Het
Mbtd1	A	G	11: 93,905,212	D25G	probably damaging	Het
Med13	T	A	11: 86,331,089	Q238L	possibly damaging	Het
Mmachc	A	G	4: 116,703,654	Y215H	probably damaging	Het
Mtor	T	A	4: 148,484,354	Y1110*	probably null	Het
Nek2	A	G	1: 191,822,219	N57D	probably damaging	Het
Nek7	ACCCC	ACCC	1: 138,515,693		probably null	Het
Neo1	G	T	9: 58,931,034	T489K	probably damaging	Het
Neu1	T	A	17: 34,934,760	Y387N	probably damaging	Het
Nfasc	A	T	1: 132,608,438	C586*	probably null	Het
Nle1	G	A	11: 82,904,845	L259F	probably damaging	Het
Nrde2	G	A	12: 100,143,846	Q309*	probably null	Het
Nufip2	C	T	11: 77,686,453	H76Y	probably benign	Het
Olfr1330	A	C	4: 118,893,490	T136P	probably damaging	Het
Olfr1383	A	T	11: 49,524,578	N285I	probably damaging	Het
Olfr466	A	T	13: 65,153,063	I280F	probably damaging	Het
Olfr584	T	C	7: 103,086,151	F206S	probably damaging	Het
Olfr670	A	T	7: 104,959,811	I307N	probably benign	Het
Olfr731	A	T	14: 50,238,639	I82N	probably damaging	Het
Pcdhb5	A	G	18: 37,321,622	T352A	probably benign	Het
Pcdhb7	A	T	18: 37,343,389	D526V	probably damaging	Het
Phkg1	A	T	5: 129,864,553		probably null	Het
Plg	C	T	17: 12,418,736	T744M	probably damaging	Het
Plxnd1	A	C	6: 115,958,699		probably benign	Het
Poglut1	A	T	16: 38,529,475	I312N	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppt1	A	G	4: 122,844,099	M77V	probably benign	Het
Pramel5	G	T	4: 144,271,620	T351N	probably damaging	Het
Psmb4	G	A	3: 94,884,964	R216C	probably benign	Het
Ptprd	T	C	4: 76,084,403	T699A	probably damaging	Het
Retreg3	A	T	11: 101,098,629		probably benign	Het
Scaper	G	A	9: 55,758,056	A389V	probably damaging	Het
Serinc5	G	A	13: 92,688,737	D225N	possibly damaging	Het
Slco1a1	T	G	6: 141,925,754		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sod3	A	T	5: 52,368,079	D40V	probably benign	Het
Sorcs3	C	A	19: 48,206,295	A39E	probably benign	Het
Spon1	A	T	7: 114,039,821	T761S	probably benign	Het
Syde2	A	G	3: 146,014,249		probably null	Het
Synm	T	A	7: 67,759,168	D154V	probably benign	Het
Synpo2	T	C	3: 123,114,449	E406G	probably damaging	Het
Tcea3	T	A	4: 136,248,071	L8*	probably null	Het
Tec	G	A	5: 72,823,497	L33F	probably damaging	Het
Tex15	T	A	8: 33,582,326	S2634T	possibly damaging	Het
Tg	T	A	15: 66,729,626	Y162N	probably damaging	Het
Tmem8b	G	A	4: 43,690,123	V853I	probably benign	Het
Togaram1	A	G	12: 65,021,466	K1748E	probably damaging	Het
Ttn	T	C	2: 76,898,478		probably benign	Het
Usp36	C	T	11: 118,273,021	D234N	probably damaging	Het
Usp40	G	A	1: 87,978,522	P664S	probably benign	Het
Vmn1r54	T	A	6: 90,269,653	L183H	probably benign	Het
Vmn1r58	T	G	7: 5,410,677	I185L	probably benign	Het
Wnt8a	A	T	18: 34,547,565	R328W	probably benign	Het
Yars	A	G	4: 129,213,939		probably benign	Het
Zbtb49	A	C	5: 38,200,674	M745R	probably damaging	Het
Zeb1	T	G	18: 5,759,027	F162V	probably damaging	Het
Zfp369	A	T	13: 65,297,548	H835L	probably damaging	Het
Zic5	A	G	14: 122,463,939	V460A	unknown	Het
Zp3	A	G	5: 135,984,356	N181D	possibly damaging	Het

Other mutations in Mast4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00703:Mast4	APN	13	102770767	nonsense	probably null
IGL00933:Mast4	APN	13	102735366	missense	probably damaging	0.97
IGL01113:Mast4	APN	13	102774236	missense	probably damaging	1.00
IGL01461:Mast4	APN	13	102754068	missense	probably damaging	1.00
IGL01569:Mast4	APN	13	102761015	missense	probably damaging	1.00
IGL01697:Mast4	APN	13	102767893	missense	probably damaging	1.00
IGL01725:Mast4	APN	13	102750512	critical splice donor site	probably null
IGL01734:Mast4	APN	13	102737615	missense	probably damaging	0.98
IGL01738:Mast4	APN	13	102737241	missense	probably damaging	1.00
IGL01739:Mast4	APN	13	102774273	missense	probably damaging	1.00
IGL02299:Mast4	APN	13	102737974	missense	probably benign	0.44
IGL02479:Mast4	APN	13	102742037	missense	probably damaging	1.00
IGL02485:Mast4	APN	13	102735496	missense	probably benign	0.02
IGL02528:Mast4	APN	13	102853823	makesense	probably null
IGL02850:Mast4	APN	13	102754232	missense	probably damaging	1.00
IGL02900:Mast4	APN	13	102735676	missense	probably benign
IGL03064:Mast4	APN	13	102760964	nonsense	probably null
IGL03124:Mast4	APN	13	102738245	missense	probably damaging	1.00
IGL03146:Mast4	APN	13	102737655	missense	probably benign	0.00
IGL03221:Mast4	APN	13	102754256	missense	possibly damaging	0.95
IGL03284:Mast4	APN	13	102751397	missense	probably damaging	1.00
IGL03406:Mast4	APN	13	102737107	missense	possibly damaging	0.46
buck	UTSW	13	102761293	critical splice donor site	probably null
doe	UTSW	13	102905677	missense	possibly damaging	0.85
skinnybones	UTSW	13	102804641	critical splice donor site	probably null
BB010:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
BB020:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
FR4304:Mast4	UTSW	13	102734862	utr 3 prime	probably benign
FR4340:Mast4	UTSW	13	102734857	frame shift	probably null
FR4340:Mast4	UTSW	13	102736317	small insertion	probably benign
FR4548:Mast4	UTSW	13	102736318	small insertion	probably benign
FR4976:Mast4	UTSW	13	102736312	small insertion	probably benign
FR4976:Mast4	UTSW	13	102739247	frame shift	probably null
NA:Mast4	UTSW	13	102742057	missense	probably damaging	1.00
PIT4466001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4469001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
PIT4472001:Mast4	UTSW	13	102804718	missense	probably damaging	1.00
R0009:Mast4	UTSW	13	102742058	missense	probably damaging	1.00
R0063:Mast4	UTSW	13	103334215	start gained	probably benign
R0242:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R0310:Mast4	UTSW	13	102754161	missense	possibly damaging	0.94
R0395:Mast4	UTSW	13	102735273	missense	probably damaging	1.00
R0454:Mast4	UTSW	13	102751560	missense	probably damaging	1.00
R0744:Mast4	UTSW	13	102737387	missense	probably damaging	0.98
R0883:Mast4	UTSW	13	102853900	missense	probably damaging	1.00
R0905:Mast4	UTSW	13	102770784	missense	probably damaging	0.99
R1023:Mast4	UTSW	13	102735496	missense	probably benign	0.02
R1281:Mast4	UTSW	13	102750578	missense	probably damaging	1.00
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1376:Mast4	UTSW	13	102736408	missense	possibly damaging	0.46
R1473:Mast4	UTSW	13	102772519	missense	probably damaging	1.00
R1572:Mast4	UTSW	13	102736923	missense	possibly damaging	0.51
R1575:Mast4	UTSW	13	102739263	missense	probably damaging	1.00
R1865:Mast4	UTSW	13	102794117	missense	probably damaging	1.00
R2050:Mast4	UTSW	13	102751409	missense	probably damaging	1.00
R2060:Mast4	UTSW	13	102738846	missense	probably damaging	1.00
R2062:Mast4	UTSW	13	102759093	missense	probably benign	0.18
R2106:Mast4	UTSW	13	102750546	missense	probably damaging	1.00
R2118:Mast4	UTSW	13	102754205	missense	probably damaging	1.00
R2143:Mast4	UTSW	13	102735475	missense	possibly damaging	0.89
R2256:Mast4	UTSW	13	102735751	missense	possibly damaging	0.62
R2261:Mast4	UTSW	13	102798207	splice site	probably benign
R2370:Mast4	UTSW	13	102774187	missense	probably damaging	1.00
R2504:Mast4	UTSW	13	102738639	missense	probably damaging	0.96
R2509:Mast4	UTSW	13	102853842	missense	probably damaging	1.00
R2842:Mast4	UTSW	13	102736431	missense	probably benign	0.01
R3087:Mast4	UTSW	13	102853926	splice site	probably benign
R3434:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3435:Mast4	UTSW	13	102787379	missense	probably damaging	1.00
R3763:Mast4	UTSW	13	102787419	missense	probably damaging	1.00
R3826:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3829:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3830:Mast4	UTSW	13	102738811	missense	probably damaging	1.00
R3913:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R3914:Mast4	UTSW	13	102739321	nonsense	probably null
R4021:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102739321	nonsense	probably null
R4022:Mast4	UTSW	13	102853869	missense	probably damaging	1.00
R4210:Mast4	UTSW	13	102739205	missense	probably damaging	1.00
R4342:Mast4	UTSW	13	102774248	missense	probably damaging	1.00
R4580:Mast4	UTSW	13	102737258	nonsense	probably null
R4627:Mast4	UTSW	13	103334021	missense	possibly damaging	0.92
R4711:Mast4	UTSW	13	103334119	missense	probably benign	0.01
R4732:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4733:Mast4	UTSW	13	102772572	missense	probably damaging	0.99
R4833:Mast4	UTSW	13	102774184	critical splice donor site	probably null
R4995:Mast4	UTSW	13	102905754	intron	probably benign
R5059:Mast4	UTSW	13	102750563	missense	probably damaging	1.00
R5073:Mast4	UTSW	13	102738883	nonsense	probably null
R5101:Mast4	UTSW	13	102736356	missense	probably benign	0.01
R5526:Mast4	UTSW	13	102754215	missense	possibly damaging	0.48
R5599:Mast4	UTSW	13	102737479	missense	probably damaging	1.00
R5673:Mast4	UTSW	13	102794072	missense	probably damaging	1.00
R5694:Mast4	UTSW	13	102774193	nonsense	probably null
R5906:Mast4	UTSW	13	102735744	missense	probably benign	0.31
R5908:Mast4	UTSW	13	102738256	missense	probably damaging	1.00
R5947:Mast4	UTSW	13	102735640	missense	probably benign
R5987:Mast4	UTSW	13	102758734	missense	probably damaging	1.00
R6143:Mast4	UTSW	13	102853883	missense	probably damaging	1.00
R6154:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6169:Mast4	UTSW	13	102787421	missense	probably damaging	1.00
R6239:Mast4	UTSW	13	102736209	missense	probably benign	0.01
R6327:Mast4	UTSW	13	102761382	missense	probably damaging	1.00
R6356:Mast4	UTSW	13	102735985	missense	possibly damaging	0.80
R6432:Mast4	UTSW	13	102905677	missense	possibly damaging	0.85
R6522:Mast4	UTSW	13	102761293	critical splice donor site	probably null
R6667:Mast4	UTSW	13	102737496	missense	probably damaging	1.00
R6941:Mast4	UTSW	13	102804714	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102798078	missense	probably damaging	1.00
R6968:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6970:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6980:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6991:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6992:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R6993:Mast4	UTSW	13	102735974	missense	probably benign	0.28
R6993:Mast4	UTSW	13	102804647	missense	probably damaging	1.00
R7083:Mast4	UTSW	13	102737715	missense	probably damaging	1.00
R7241:Mast4	UTSW	13	103334000	missense	possibly damaging	0.87
R7242:Mast4	UTSW	13	102738478	missense	probably damaging	1.00
R7246:Mast4	UTSW	13	102794003	missense	probably damaging	1.00
R7332:Mast4	UTSW	13	102751424	missense	possibly damaging	0.61
R7453:Mast4	UTSW	13	102804641	critical splice donor site	probably null
R7514:Mast4	UTSW	13	102787426	nonsense	probably null
R7697:Mast4	UTSW	13	102739203	missense	probably damaging	1.00
R7820:Mast4	UTSW	13	102754088	missense	probably damaging	1.00
R7874:Mast4	UTSW	13	102739275	missense	probably damaging	1.00
R7933:Mast4	UTSW	13	102772563	missense	probably damaging	0.99
R8042:Mast4	UTSW	13	102781245	missense	probably damaging	0.96
R8060:Mast4	UTSW	13	102737676	missense	possibly damaging	0.89
R8172:Mast4	UTSW	13	102953125	critical splice donor site	probably null
R8206:Mast4	UTSW	13	102735739	missense	probably damaging	1.00
R8248:Mast4	UTSW	13	102738721	missense	probably damaging	1.00
R8283:Mast4	UTSW	13	102758669	missense	probably damaging	1.00
R8346:Mast4	UTSW	13	102751478	missense	probably damaging	0.99
R8434:Mast4	UTSW	13	102761392	missense	probably damaging	1.00
R8796:Mast4	UTSW	13	102783391	missense	probably benign	0.07
R8850:Mast4	UTSW	13	102758666	missense	probably damaging	1.00
R9012:Mast4	UTSW	13	102798098	missense	probably benign	0.05
R9375:Mast4	UTSW	13	102781245	missense	probably damaging	0.99
R9389:Mast4	UTSW	13	103333930	missense	probably benign	0.00
R9404:Mast4	UTSW	13	102751425	missense	probably damaging	1.00
R9520:Mast4	UTSW	13	102789024	missense	probably damaging	1.00
R9525:Mast4	UTSW	13	102736436	missense	probably benign	0.00
R9526:Mast4	UTSW	13	102737085	missense	probably benign	0.00
R9709:Mast4	UTSW	13	102774203	missense	probably damaging	1.00
R9790:Mast4	UTSW	13	102754197	missense	probably benign	0.01
R9791:Mast4	UTSW	13	102754197	missense	probably benign	0.01
RF005:Mast4	UTSW	13	102736307	small insertion	probably benign
RF015:Mast4	UTSW	13	102739247	frame shift	probably null
RF019:Mast4	UTSW	13	102736307	small insertion	probably benign
RF037:Mast4	UTSW	13	102739241	small deletion	probably benign
RF039:Mast4	UTSW	13	102739241	small deletion	probably benign
RF040:Mast4	UTSW	13	102739241	small deletion	probably benign
Z1088:Mast4	UTSW	13	102738519	missense	probably damaging	1.00
Z1176:Mast4	UTSW	13	102738460	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTAGAGCCACTTGACAGTATGGTGC -3'
(R):5'- TATTCGCCCCGCAGGTTTTCAG -3'

Sequencing Primer
(F):5'- ACACTTACCTGACAGTGTGG -3'
(R):5'- gagacccacgcccagag -3'

Posted On

2013-07-11