Incidental Mutation 'R7371:Or2a12'
ID 572074
Institutional Source Beutler Lab
Gene Symbol Or2a12
Ensembl Gene ENSMUSG00000073111
Gene Name olfactory receptor family 2 subfamily A member 12
Synonyms MOR261-12, GA_x6K02T2P3E9-4632269-4631343, Olfr446
MMRRC Submission 045454-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.153) question?
Stock # R7371 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 42904167-42905093 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 42904469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 101 (Y101*)
Ref Sequence ENSEMBL: ENSMUSP00000149013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101461] [ENSMUST00000215369] [ENSMUST00000215686] [ENSMUST00000216199]
AlphaFold Q8VEV0
Predicted Effect probably null
Transcript: ENSMUST00000101461
AA Change: Y101*
SMART Domains Protein: ENSMUSP00000099005
Gene: ENSMUSG00000073111
AA Change: Y101*

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 1.7e-62 PFAM
Pfam:7TM_GPCR_Srsx 32 282 1.7e-5 PFAM
Pfam:7tm_1 38 287 3.2e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215369
AA Change: Y101*
Predicted Effect probably null
Transcript: ENSMUST00000215686
AA Change: Y101*
Predicted Effect probably null
Transcript: ENSMUST00000216199
AA Change: Y101*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam21 A C 12: 81,607,064 (GRCm39) S233A probably damaging Het
Adcy8 T A 15: 64,571,067 (GRCm39) H1222L probably benign Het
Aftph T C 11: 20,676,836 (GRCm39) T258A probably benign Het
Ano3 A C 2: 110,715,194 (GRCm39) probably null Het
Aox4 A G 1: 58,303,013 (GRCm39) D1148G probably damaging Het
Bcl11b A T 12: 107,955,750 (GRCm39) I133N probably damaging Het
Borcs7 T A 19: 46,688,057 (GRCm39) D67E probably damaging Het
Cacna2d4 T A 6: 119,285,670 (GRCm39) I774N probably benign Het
Catsperd A T 17: 56,957,801 (GRCm39) Y236F probably benign Het
Cblc T C 7: 19,526,828 (GRCm39) S135G probably benign Het
Ccdc168 C A 1: 44,100,537 (GRCm39) R187L probably benign Het
Ccdc178 A G 18: 22,263,195 (GRCm39) V138A probably benign Het
Cd300ld C T 11: 114,878,186 (GRCm39) G109R probably damaging Het
Cdh3 T A 8: 107,279,109 (GRCm39) N690K probably damaging Het
Ceacam1 T A 7: 25,174,145 (GRCm39) Y170F possibly damaging Het
Ceacam9 A C 7: 16,457,652 (GRCm39) H55P possibly damaging Het
Celsr1 C T 15: 85,914,875 (GRCm39) V1033I possibly damaging Het
Cep97 T C 16: 55,725,683 (GRCm39) S807G probably benign Het
Ces1b A G 8: 93,783,982 (GRCm39) probably null Het
Chn1 T C 2: 73,510,234 (GRCm39) T92A probably damaging Het
Cimap1b C A 15: 89,263,365 (GRCm39) W6L probably damaging Het
Cngb3 A C 4: 19,425,575 (GRCm39) Y461S possibly damaging Het
Col24a1 A G 3: 145,049,459 (GRCm39) N629S probably benign Het
Cpd T C 11: 76,737,437 (GRCm39) D119G probably benign Het
Cpsf1 T C 15: 76,484,775 (GRCm39) D594G probably damaging Het
Cpsf7 C T 19: 10,509,203 (GRCm39) A38V probably benign Het
Cry1 A T 10: 84,983,783 (GRCm39) H224Q probably benign Het
Ctr9 T A 7: 110,633,014 (GRCm39) D87E probably damaging Het
Cyp2u1 T A 3: 131,087,144 (GRCm39) N479I probably benign Het
Dip2c A G 13: 9,642,785 (GRCm39) N672D probably benign Het
Dnah14 T C 1: 181,454,450 (GRCm39) V820A probably benign Het
Efnb2 T C 8: 8,710,524 (GRCm39) I31V probably benign Het
Fgb T C 3: 82,953,359 (GRCm39) Y137C probably damaging Het
Fkbp15 A G 4: 62,239,293 (GRCm39) V604A possibly damaging Het
Flii A T 11: 60,609,090 (GRCm39) N682K probably benign Het
Fmo3 A G 1: 162,781,796 (GRCm39) L519P possibly damaging Het
Gapvd1 T A 2: 34,607,385 (GRCm39) M538L probably benign Het
Gbp11 A G 5: 105,489,971 (GRCm39) V69A probably benign Het
Ggn T A 7: 28,871,605 (GRCm39) D364E probably benign Het
Gm10377 G A 14: 42,614,853 (GRCm39) P171S probably benign Het
Gramd4 C T 15: 86,019,607 (GRCm39) A625V probably benign Het
Il2ra T A 2: 11,647,831 (GRCm39) M7K probably benign Het
Iqgap2 A T 13: 95,836,846 (GRCm39) probably null Het
Itgb4 T C 11: 115,888,906 (GRCm39) V1083A probably benign Het
Kcnma1 G A 14: 23,544,638 (GRCm39) A573V possibly damaging Het
Kirrel1 T C 3: 86,995,729 (GRCm39) T402A probably benign Het
Krt15 A T 11: 100,026,386 (GRCm39) V100E possibly damaging Het
Krt4 T A 15: 101,828,823 (GRCm39) Q347L probably damaging Het
Map3k21 T A 8: 126,661,804 (GRCm39) I467N probably damaging Het
Mastl A T 2: 23,030,585 (GRCm39) S195T probably damaging Het
Mis18bp1 G T 12: 65,205,368 (GRCm39) T268K probably benign Het
Mmp17 G A 5: 129,682,836 (GRCm39) G492S probably null Het
Myc T A 15: 61,860,031 (GRCm39) S236T probably damaging Het
Nlrp5 A T 7: 23,117,848 (GRCm39) E524V probably damaging Het
Nopchap1 T C 10: 83,201,680 (GRCm39) V151A probably benign Het
Npr3 T A 15: 11,845,376 (GRCm39) probably null Het
Oog4 T C 4: 143,165,346 (GRCm39) N267S possibly damaging Het
Or4l15 A T 14: 50,198,563 (GRCm39) probably null Het
Or56a5 A G 7: 104,793,086 (GRCm39) I138T possibly damaging Het
Pde4dip T C 3: 97,664,587 (GRCm39) E425G probably benign Het
Piwil4 A C 9: 14,638,729 (GRCm39) N312K probably benign Het
Pmepa1 A G 2: 173,076,212 (GRCm39) M47T possibly damaging Het
Potefam1 A T 2: 111,023,826 (GRCm39) S475T unknown Het
Prkcg G A 7: 3,368,069 (GRCm39) G372D probably benign Het
Prune2 A G 19: 17,096,734 (GRCm39) H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,457,261 (GRCm39) probably benign Het
Rab3gap2 C G 1: 184,983,265 (GRCm39) A468G probably damaging Het
Ralb A G 1: 119,400,129 (GRCm39) L123P Het
Ralgapa2 G A 2: 146,189,046 (GRCm39) T1288I probably benign Het
Samd4b C A 7: 28,122,926 (GRCm39) C44F probably benign Het
Satb1 C A 17: 52,090,008 (GRCm39) E280* probably null Het
Sec1 T C 7: 45,328,034 (GRCm39) T338A probably damaging Het
Sec16a T C 2: 26,331,734 (GRCm39) T94A probably benign Het
Serpina1f G A 12: 103,656,086 (GRCm39) R381W probably damaging Het
Sfswap A T 5: 129,620,305 (GRCm39) T525S probably benign Het
Skor1 T C 9: 63,054,169 (GRCm39) probably null Het
Spc24 A G 9: 21,668,664 (GRCm39) L111P probably damaging Het
St8sia2 T C 7: 73,616,675 (GRCm39) D121G probably damaging Het
Tanc2 A G 11: 105,689,422 (GRCm39) T195A probably benign Het
Tbc1d9 T A 8: 83,997,890 (GRCm39) I1149N probably damaging Het
Tph2 A T 10: 114,987,016 (GRCm39) L258Q probably damaging Het
Trpm3 A T 19: 22,879,557 (GRCm39) M781L probably benign Het
Ubap2 G T 4: 41,195,779 (GRCm39) P1005T probably benign Het
Upf2 A G 2: 5,965,851 (GRCm39) E157G unknown Het
Urb2 C A 8: 124,755,008 (GRCm39) D238E probably benign Het
Vipr1 T C 9: 121,497,621 (GRCm39) S380P probably damaging Het
Zc3h18 T A 8: 123,139,760 (GRCm39) S734T unknown Het
Zmym6 T A 4: 126,998,106 (GRCm39) Y381N probably damaging Het
Zscan4e T C 7: 11,041,251 (GRCm39) K207R probably benign Het
Other mutations in Or2a12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02947:Or2a12 APN 6 42,904,830 (GRCm39) missense probably benign 0.24
IGL03164:Or2a12 APN 6 42,905,064 (GRCm39) nonsense probably null
PIT4519001:Or2a12 UTSW 6 42,904,578 (GRCm39) missense probably damaging 1.00
R1760:Or2a12 UTSW 6 42,904,431 (GRCm39) missense possibly damaging 0.90
R1883:Or2a12 UTSW 6 42,904,764 (GRCm39) missense probably damaging 0.99
R1884:Or2a12 UTSW 6 42,904,764 (GRCm39) missense probably damaging 0.99
R2180:Or2a12 UTSW 6 42,904,459 (GRCm39) missense probably benign 0.14
R3001:Or2a12 UTSW 6 42,904,888 (GRCm39) missense probably damaging 1.00
R3002:Or2a12 UTSW 6 42,904,888 (GRCm39) missense probably damaging 1.00
R4435:Or2a12 UTSW 6 42,905,023 (GRCm39) missense probably damaging 1.00
R4544:Or2a12 UTSW 6 42,904,348 (GRCm39) missense probably damaging 1.00
R4546:Or2a12 UTSW 6 42,904,348 (GRCm39) missense probably damaging 1.00
R5009:Or2a12 UTSW 6 42,904,367 (GRCm39) missense probably damaging 1.00
R5236:Or2a12 UTSW 6 42,904,715 (GRCm39) missense probably benign 0.04
R5290:Or2a12 UTSW 6 42,904,972 (GRCm39) missense probably damaging 0.98
R5297:Or2a12 UTSW 6 42,904,371 (GRCm39) missense probably benign 0.17
R9308:Or2a12 UTSW 6 42,904,749 (GRCm39) missense probably benign 0.14
R9364:Or2a12 UTSW 6 42,904,534 (GRCm39) missense probably damaging 1.00
R9404:Or2a12 UTSW 6 42,904,750 (GRCm39) missense probably benign 0.14
X0065:Or2a12 UTSW 6 42,904,990 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CCTCACGTTGATGGGAAATGG -3'
(R):5'- TTTTGTGGCCCACAGAATGG -3'

Sequencing Primer
(F):5'- AAATGGGATTATCCTGGGGCTCATC -3'
(R):5'- CCACAGAATGGGAGTCTTAGAATG -3'
Posted On 2019-09-13