Incidental Mutation 'R7371:Ceacam9'
ID572078
Institutional Source Beutler Lab
Gene Symbol Ceacam9
Ensembl Gene ENSMUSG00000007209
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 9
SynonymsmmCGM8, Cea5, Cea-5
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location16721929-16726132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16723727 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 55 (H55P)
Ref Sequence ENSEMBL: ENSMUSP00000001984 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001984] [ENSMUST00000206252]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001984
AA Change: H55P

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001984
Gene: ENSMUSG00000007209
AA Change: H55P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
IG 40 140 6.76e-1 SMART
IGc2 156 220 3.33e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206252
AA Change: H60P

PolyPhen 2 Score 0.446 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype PHENOTYPE: Animals homozygous for a mutation in this gene are fertile, viable, and exhibit normal growth and development with normal reproductive system morphology and physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Ceacam9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Ceacam9 APN 7 16723961 missense probably damaging 0.98
IGL02156:Ceacam9 APN 7 16723619 splice site probably benign
R1891:Ceacam9 UTSW 7 16723955 missense probably damaging 0.98
R1981:Ceacam9 UTSW 7 16725307 missense probably benign 0.16
R1982:Ceacam9 UTSW 7 16725307 missense probably benign 0.16
R2121:Ceacam9 UTSW 7 16722003 missense probably benign 0.00
R4656:Ceacam9 UTSW 7 16723649 missense probably benign 0.03
R4678:Ceacam9 UTSW 7 16725409 missense probably damaging 1.00
R5026:Ceacam9 UTSW 7 16725197 critical splice acceptor site probably null
R7466:Ceacam9 UTSW 7 16723855 missense probably benign 0.00
R7810:Ceacam9 UTSW 7 16723733 missense possibly damaging 0.84
RF022:Ceacam9 UTSW 7 16725379 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATGACACAGTTCCCCTGCAC -3'
(R):5'- TGACGTTTCTGATCAGCAGG -3'

Sequencing Primer
(F):5'- CACCGAGCAAGTGAGGCAC -3'
(R):5'- GTTTCTGATCAGCAGGGATCCAC -3'
Posted On2019-09-13