Incidental Mutation 'R7371:Cblc'
ID572079
Institutional Source Beutler Lab
Gene Symbol Cblc
Ensembl Gene ENSMUSG00000040525
Gene NameCasitas B-lineage lymphoma c
Synonyms2310076I21Rik, Cbl3, 2310079L19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19778881-19796809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19792903 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 135 (S135G)
Ref Sequence ENSEMBL: ENSMUSP00000039955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043822] [ENSMUST00000108449]
Predicted Effect probably benign
Transcript: ENSMUST00000043822
AA Change: S135G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039955
Gene: ENSMUSG00000040525
AA Change: S135G

DomainStartEndE-ValueType
Pfam:Cbl_N 13 144 2.6e-44 PFAM
Pfam:Cbl_N2 148 231 1.8e-35 PFAM
SH2 234 347 4.35e0 SMART
RING 350 388 1.92e-6 SMART
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108449
AA Change: S135G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000104088
Gene: ENSMUSG00000040525
AA Change: S135G

DomainStartEndE-ValueType
Pfam:Cbl_N 11 145 7.1e-20 PFAM
Pfam:Cbl_N2 147 231 2.3e-48 PFAM
SH2 234 333 5.28e0 SMART
low complexity region 414 429 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Cbl family of E3 ubiquitin ligases. Cbl proteins play important roles in cell signaling through the ubiquitination and subsequent downregulation of tyrosine kinases. Expression of this gene may be restricted to epithelial cells, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no abnormalities of the epithelium or other tissues. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Cblc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Cblc APN 7 19785275 missense probably benign 0.00
R0583:Cblc UTSW 7 19792561 missense probably benign 0.41
R0847:Cblc UTSW 7 19790534 nonsense probably null
R1594:Cblc UTSW 7 19792546 missense probably damaging 1.00
R1626:Cblc UTSW 7 19796502 missense probably damaging 1.00
R1719:Cblc UTSW 7 19790474 missense probably benign 0.00
R1894:Cblc UTSW 7 19792577 missense probably damaging 0.99
R2011:Cblc UTSW 7 19784822 missense probably benign 0.01
R2395:Cblc UTSW 7 19785380 missense probably damaging 1.00
R2852:Cblc UTSW 7 19780964 splice site probably null
R3832:Cblc UTSW 7 19792172 missense probably damaging 0.98
R4696:Cblc UTSW 7 19796482 missense probably damaging 1.00
R5159:Cblc UTSW 7 19785308 missense probably benign 0.01
R5328:Cblc UTSW 7 19792580 missense possibly damaging 0.68
R5487:Cblc UTSW 7 19784808 missense probably benign 0.06
R5659:Cblc UTSW 7 19792932 missense probably damaging 1.00
R6209:Cblc UTSW 7 19785305 missense possibly damaging 0.47
R6519:Cblc UTSW 7 19792863 missense probably damaging 1.00
R6841:Cblc UTSW 7 19792896 missense probably damaging 1.00
R7417:Cblc UTSW 7 19788974 missense probably benign 0.41
R7494:Cblc UTSW 7 19792812 missense possibly damaging 0.76
R8195:Cblc UTSW 7 19785337 missense possibly damaging 0.78
R8253:Cblc UTSW 7 19786232 missense probably damaging 1.00
X0028:Cblc UTSW 7 19785273 missense probably benign
Z1177:Cblc UTSW 7 19785278 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AAGGTGGTATGGTTACAGCTACG -3'
(R):5'- ACTGAGACTGGCTCTTGGTAC -3'

Sequencing Primer
(F):5'- ATAGGAAGAGGCTGTTCTCCC -3'
(R):5'- TGATGCTCATAGCTTCCC -3'
Posted On2019-09-13