Incidental Mutation 'R7371:Dip2c'
ID572112
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.574) question?
Stock #R7371 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9592749 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 672 (N672D)
Ref Sequence ENSEMBL: ENSMUSP00000126827 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably benign
Transcript: ENSMUST00000166299
AA Change: N672D

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: N672D

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174552
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Catsperd A T 17: 56,650,801 Y236F probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1481:Dip2c UTSW 13 9551866 critical splice donor site probably null
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TATGGCGCTGTGAAAAGTTTC -3'
(R):5'- CTAACAGTGAAATGCTTGCTTTCC -3'

Sequencing Primer
(F):5'- GGGGTTAGAATGCTCATG -3'
(R):5'- GACACACCTTTGAGGATGTCC -3'
Posted On2019-09-13