Incidental Mutation 'R7371:Catsperd'
ID572125
Institutional Source Beutler Lab
Gene Symbol Catsperd
Ensembl Gene ENSMUSG00000040828
Gene Namecation channel sperm associated auxiliary subunit delta
Synonyms4933402B14Rik, 4921529N20Rik, Gm6095, Tmem146
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R7371 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56628143-56664456 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 56650801 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 236 (Y236F)
Ref Sequence ENSEMBL: ENSMUSP00000108603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112979]
Predicted Effect probably benign
Transcript: ENSMUST00000112979
AA Change: Y236F

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108603
Gene: ENSMUSG00000040828
AA Change: Y236F

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Pfam:CATSPERD 38 766 N/A PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (88/90)
MGI Phenotype PHENOTYPE: Mice homozygous for a deletion in this gene display male infertility. Hyperactivity of sperm fails to develop under capacitating conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik A T 2: 111,193,481 S475T unknown Het
Adam21 A C 12: 81,560,290 S233A probably damaging Het
Adcy8 T A 15: 64,699,218 H1222L probably benign Het
Aftph T C 11: 20,726,836 T258A probably benign Het
Ano3 A C 2: 110,884,849 probably null Het
Aox4 A G 1: 58,263,854 D1148G probably damaging Het
Bcl11b A T 12: 107,989,491 I133N probably damaging Het
Borcs7 T A 19: 46,699,618 D67E probably damaging Het
Cacna2d4 T A 6: 119,308,709 I774N probably benign Het
Cblc T C 7: 19,792,903 S135G probably benign Het
Ccdc178 A G 18: 22,130,138 V138A probably benign Het
Cd300ld C T 11: 114,987,360 G109R probably damaging Het
Cdh3 T A 8: 106,552,477 N690K probably damaging Het
Ceacam1 T A 7: 25,474,720 Y170F possibly damaging Het
Ceacam9 A C 7: 16,723,727 H55P possibly damaging Het
Celsr1 C T 15: 86,030,674 V1033I possibly damaging Het
Cep97 T C 16: 55,905,320 S807G probably benign Het
Ces1b A G 8: 93,057,354 probably null Het
Chn1 T C 2: 73,679,890 T92A probably damaging Het
Cngb3 A C 4: 19,425,575 Y461S possibly damaging Het
Col24a1 A G 3: 145,343,698 N629S probably benign Het
Cpd T C 11: 76,846,611 D119G probably benign Het
Cpsf1 T C 15: 76,600,575 D594G probably damaging Het
Cpsf7 C T 19: 10,531,839 A38V probably benign Het
Cry1 A T 10: 85,147,919 H224Q probably benign Het
Ctr9 T A 7: 111,033,807 D87E probably damaging Het
Cyp2u1 T A 3: 131,293,495 N479I probably benign Het
D10Wsu102e T C 10: 83,365,816 V151A probably benign Het
Dip2c A G 13: 9,592,749 N672D probably benign Het
Dnah14 T C 1: 181,626,885 V820A probably benign Het
Efnb2 T C 8: 8,660,524 I31V probably benign Het
Fgb T C 3: 83,046,052 Y137C probably damaging Het
Fkbp15 A G 4: 62,321,056 V604A possibly damaging Het
Flii A T 11: 60,718,264 N682K probably benign Het
Fmo3 A G 1: 162,954,227 L519P possibly damaging Het
Gapvd1 T A 2: 34,717,373 M538L probably benign Het
Gbp11 A G 5: 105,342,105 V69A probably benign Het
Ggn T A 7: 29,172,180 D364E probably benign Het
Gm10377 G A 14: 42,792,896 P171S probably benign Het
Gm8251 C A 1: 44,061,377 R187L probably benign Het
Gramd4 C T 15: 86,135,406 A625V probably benign Het
Il2ra T A 2: 11,643,020 M7K probably benign Het
Iqgap2 A T 13: 95,700,338 probably null Het
Itgb4 T C 11: 115,998,080 V1083A probably benign Het
Kcnma1 G A 14: 23,494,570 A573V possibly damaging Het
Kirrel T C 3: 87,088,422 T402A probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Krt4 T A 15: 101,920,388 Q347L probably damaging Het
Map3k21 T A 8: 125,935,065 I467N probably damaging Het
Mastl A T 2: 23,140,573 S195T probably damaging Het
Mis18bp1 G T 12: 65,158,594 T268K probably benign Het
Mmp17 G A 5: 129,605,772 G492S probably null Het
Myc T A 15: 61,988,182 S236T probably damaging Het
Nlrp5 A T 7: 23,418,423 E524V probably damaging Het
Npr3 T A 15: 11,845,290 probably null Het
Odf3b C A 15: 89,379,162 W6L probably damaging Het
Olfr446 T A 6: 42,927,535 Y101* probably null Het
Olfr683 A G 7: 105,143,879 I138T possibly damaging Het
Olfr724 A T 14: 49,961,106 probably null Het
Oog4 T C 4: 143,438,776 N267S possibly damaging Het
Pde4dip T C 3: 97,757,271 E425G probably benign Het
Piwil4 A C 9: 14,727,433 N312K probably benign Het
Pmepa1 A G 2: 173,234,419 M47T possibly damaging Het
Prkcg G A 7: 3,319,553 G372D probably benign Het
Prune2 A G 19: 17,119,370 H746R probably benign Het
Ptma GGAAGAAG GGAAGAAGAAG 1: 86,529,539 probably benign Het
Rab3gap2 C G 1: 185,251,068 A468G probably damaging Het
Ralb A G 1: 119,472,399 L123P Het
Ralgapa2 G A 2: 146,347,126 T1288I probably benign Het
Samd4b C A 7: 28,423,501 C44F probably benign Het
Satb1 C A 17: 51,782,980 E280* probably null Het
Sec1 T C 7: 45,678,610 T338A probably damaging Het
Sec16a T C 2: 26,441,722 T94A probably benign Het
Serpina1f G A 12: 103,689,827 R381W probably damaging Het
Sfswap A T 5: 129,543,241 T525S probably benign Het
Skor1 T C 9: 63,146,887 probably null Het
Spc24 A G 9: 21,757,368 L111P probably damaging Het
St8sia2 T C 7: 73,966,927 D121G probably damaging Het
Tanc2 A G 11: 105,798,596 T195A probably benign Het
Tbc1d9 T A 8: 83,271,261 I1149N probably damaging Het
Tph2 A T 10: 115,151,111 L258Q probably damaging Het
Trpm3 A T 19: 22,902,193 M781L probably benign Het
Ubap2 G T 4: 41,195,779 P1005T probably benign Het
Upf2 A G 2: 5,961,040 E157G unknown Het
Urb2 C A 8: 124,028,269 D238E probably benign Het
Vipr1 T C 9: 121,668,555 S380P probably damaging Het
Zc3h18 T A 8: 122,413,021 S734T unknown Het
Zmym6 T A 4: 127,104,313 Y381N probably damaging Het
Zscan4e T C 7: 11,307,324 K207R probably benign Het
Other mutations in Catsperd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02514:Catsperd APN 17 56661271 missense probably damaging 0.98
IGL02598:Catsperd APN 17 56647815 splice site probably null
IGL03037:Catsperd APN 17 56641583 missense possibly damaging 0.80
IGL03330:Catsperd APN 17 56632316 missense possibly damaging 0.45
R0391:Catsperd UTSW 17 56662821 missense probably benign 0.00
R0463:Catsperd UTSW 17 56659554 missense probably damaging 0.99
R0506:Catsperd UTSW 17 56658078 missense possibly damaging 0.95
R0538:Catsperd UTSW 17 56662828 missense probably benign 0.00
R0550:Catsperd UTSW 17 56663427 critical splice donor site probably null
R1503:Catsperd UTSW 17 56654525 missense possibly damaging 0.63
R1705:Catsperd UTSW 17 56633521 missense probably damaging 0.97
R1919:Catsperd UTSW 17 56635548 missense probably damaging 0.99
R2851:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R2852:Catsperd UTSW 17 56660169 critical splice acceptor site probably null
R3147:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R3148:Catsperd UTSW 17 56664039 missense possibly damaging 0.86
R4084:Catsperd UTSW 17 56654453 missense probably benign 0.14
R4329:Catsperd UTSW 17 56654517 missense possibly damaging 0.80
R4940:Catsperd UTSW 17 56662736 missense possibly damaging 0.95
R4944:Catsperd UTSW 17 56662744 missense probably damaging 0.97
R4952:Catsperd UTSW 17 56632303 missense probably damaging 0.99
R5079:Catsperd UTSW 17 56658153 critical splice donor site probably null
R5259:Catsperd UTSW 17 56660235 missense possibly damaging 0.93
R5635:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R5929:Catsperd UTSW 17 56652493 missense probably benign 0.00
R6789:Catsperd UTSW 17 56654426 splice site probably null
R6909:Catsperd UTSW 17 56650781 missense probably damaging 0.96
R6920:Catsperd UTSW 17 56655175 nonsense probably null
R7099:Catsperd UTSW 17 56628811 splice site probably null
R7106:Catsperd UTSW 17 56658070 splice site probably null
R7405:Catsperd UTSW 17 56632335 missense possibly damaging 0.95
R7478:Catsperd UTSW 17 56664055 missense probably benign 0.00
R7781:Catsperd UTSW 17 56664072 missense probably benign 0.00
R7918:Catsperd UTSW 17 56631564 missense probably benign 0.06
R7981:Catsperd UTSW 17 56631562 missense possibly damaging 0.85
R8200:Catsperd UTSW 17 56632368 critical splice donor site probably null
R8487:Catsperd UTSW 17 56663419 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGTACTCTGTGGTACCCTG -3'
(R):5'- GCCTGGTCAACTTAGTGAAATTTTG -3'

Sequencing Primer
(F):5'- TACTCTGTGGTACCCTGGGAAGAC -3'
(R):5'- TGAGCAATTGATGAACCCCTCTGG -3'
Posted On2019-09-13