Incidental Mutation 'R7372:Spta1'
ID572134
Institutional Source Beutler Lab
Gene Symbol Spta1
Ensembl Gene ENSMUSG00000026532
Gene Namespectrin alpha, erythrocytic 1
Synonymserythroid, Spna-1, ihj, Spna1
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.721) question?
Stock #R7372 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location174172776-174248450 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 174197635 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 689 (Q689*)
Ref Sequence ENSEMBL: ENSMUSP00000027817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027817]
Predicted Effect probably null
Transcript: ENSMUST00000027817
AA Change: Q689*
SMART Domains Protein: ENSMUSP00000027817
Gene: ENSMUSG00000026532
AA Change: Q689*

DomainStartEndE-ValueType
SPEC 55 153 3.62e-11 SMART
SPEC 159 259 1.84e-26 SMART
SPEC 265 365 1.56e-24 SMART
SPEC 371 471 8.35e-25 SMART
SPEC 477 577 1.19e-29 SMART
SPEC 583 682 2.43e-26 SMART
SPEC 688 788 1.3e-26 SMART
SPEC 794 894 1.66e-28 SMART
SPEC 900 1077 5.03e-19 SMART
SH3 978 1033 2.98e-15 SMART
SPEC 1083 1178 2.57e-16 SMART
SPEC 1184 1284 1.15e-27 SMART
SPEC 1290 1390 7.05e-23 SMART
SPEC 1396 1495 6.04e-22 SMART
SPEC 1501 1602 1.15e-27 SMART
SPEC 1608 1708 5.46e-29 SMART
SPEC 1714 1814 1.08e-32 SMART
SPEC 1820 1921 2.17e-23 SMART
SPEC 1927 2028 2.19e-19 SMART
SPEC 2042 2142 3.87e-11 SMART
SPEC 2156 2253 9.77e-8 SMART
low complexity region 2307 2318 N/A INTRINSIC
efhand_Ca_insen 2346 2414 2.37e-27 SMART
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is a tetramer made up of alpha-beta dimers linked in a head-to-head arrangement. This gene is one member of a family of alpha-spectrin genes. The encoded protein is primarily composed of 22 spectrin repeats which are involved in dimer formation. It forms weaker tetramer interactions than non-erythrocytic alpha spectrin, which may increase the plasma membrane elasticity and deformability of red blood cells. Mutations in this gene result in a variety of hereditary red blood cell disorders, including elliptocytosis type 2, pyropoikilocytosis, and spherocytic hemolytic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit microcytic, hypochromic, hemolytic anemia, jaundice, and high neonatal mortality. Heterozygotes of some alleles may exhibit a mild spherocytic transition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cd209a T A 8: 3,748,857 probably null Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Crhr1 A G 11: 104,163,893 probably null Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Kif5c T A 2: 49,758,659 probably null Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tbc1d9b A G 11: 50,168,688 probably null Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Usp17lb A T 7: 104,841,706 probably null Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Spta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Spta1 APN 1 174208390 nonsense probably null
IGL01095:Spta1 APN 1 174213485 missense probably benign 0.02
IGL01144:Spta1 APN 1 174187263 missense probably benign 0.05
IGL01455:Spta1 APN 1 174203311 missense possibly damaging 0.78
IGL01541:Spta1 APN 1 174217159 missense probably benign 0.03
IGL01613:Spta1 APN 1 174208394 missense probably damaging 1.00
IGL01804:Spta1 APN 1 174244180 missense probably benign 0.42
IGL01859:Spta1 APN 1 174174372 missense probably damaging 1.00
IGL01898:Spta1 APN 1 174213862 missense probably benign 0.00
IGL02106:Spta1 APN 1 174203294 missense probably benign 0.02
IGL02166:Spta1 APN 1 174190231 missense probably damaging 1.00
IGL02224:Spta1 APN 1 174217689 critical splice donor site probably benign
IGL02318:Spta1 APN 1 174174463 missense possibly damaging 0.51
IGL02392:Spta1 APN 1 174218814 missense probably damaging 0.96
IGL02852:Spta1 APN 1 174244110 missense probably benign 0.24
IGL02861:Spta1 APN 1 174211598 missense probably damaging 1.00
IGL02982:Spta1 APN 1 174187288 missense probably benign 0.00
IGL03057:Spta1 APN 1 174181058 missense probably benign 0.19
IGL03215:Spta1 APN 1 174218743 missense probably damaging 1.00
IGL03263:Spta1 APN 1 174213918 missense probably damaging 0.99
IGL03272:Spta1 APN 1 174214144 missense probably benign 0.08
H8786:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0003:Spta1 UTSW 1 174205273 missense probably damaging 0.98
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0010:Spta1 UTSW 1 174217943 missense probably benign 0.03
R0078:Spta1 UTSW 1 174207032 splice site probably benign
R0172:Spta1 UTSW 1 174230786 missense probably damaging 1.00
R0206:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0208:Spta1 UTSW 1 174192960 missense probably damaging 1.00
R0276:Spta1 UTSW 1 174217894 missense probably damaging 1.00
R0288:Spta1 UTSW 1 174243179 missense probably damaging 0.99
R0323:Spta1 UTSW 1 174218451 missense probably damaging 1.00
R0454:Spta1 UTSW 1 174213942 missense probably damaging 1.00
R0508:Spta1 UTSW 1 174224457 missense probably damaging 1.00
R0698:Spta1 UTSW 1 174181104 missense probably damaging 1.00
R0751:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R0925:Spta1 UTSW 1 174174426 missense possibly damaging 0.85
R0941:Spta1 UTSW 1 174245205 unclassified probably benign
R1131:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R1171:Spta1 UTSW 1 174211614 nonsense probably null
R1184:Spta1 UTSW 1 174184690 missense probably damaging 1.00
R1401:Spta1 UTSW 1 174222684 missense probably damaging 1.00
R1489:Spta1 UTSW 1 174231325 missense probably damaging 0.97
R1532:Spta1 UTSW 1 174247353 missense probably damaging 0.99
R1551:Spta1 UTSW 1 174240166 missense possibly damaging 0.94
R1555:Spta1 UTSW 1 174178749 missense probably damaging 0.99
R1566:Spta1 UTSW 1 174184706 missense probably benign 0.00
R1586:Spta1 UTSW 1 174213495 missense probably benign 0.00
R1676:Spta1 UTSW 1 174179839 missense probably damaging 0.98
R1711:Spta1 UTSW 1 174241042 missense probably damaging 1.00
R1795:Spta1 UTSW 1 174245730 missense probably damaging 1.00
R1823:Spta1 UTSW 1 174246549 missense probably benign 0.05
R1842:Spta1 UTSW 1 174195947 missense probably benign 0.00
R1867:Spta1 UTSW 1 174219839 missense probably benign 0.33
R1970:Spta1 UTSW 1 174240367 missense possibly damaging 0.88
R2042:Spta1 UTSW 1 174211647 missense probably benign 0.20
R2095:Spta1 UTSW 1 174244198 missense possibly damaging 0.75
R2125:Spta1 UTSW 1 174208344 missense possibly damaging 0.80
R2145:Spta1 UTSW 1 174212614 missense probably benign 0.00
R2158:Spta1 UTSW 1 174229258 missense probably benign 0.41
R2187:Spta1 UTSW 1 174192966 missense probably damaging 1.00
R2250:Spta1 UTSW 1 174244114 missense probably damaging 1.00
R2258:Spta1 UTSW 1 174174341 missense possibly damaging 0.76
R2319:Spta1 UTSW 1 174178656 critical splice acceptor site probably null
R3782:Spta1 UTSW 1 174208314 missense probably damaging 1.00
R4058:Spta1 UTSW 1 174241137 missense probably damaging 1.00
R4080:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4081:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4082:Spta1 UTSW 1 174214066 missense probably benign 0.00
R4108:Spta1 UTSW 1 174174556 missense probably benign 0.01
R4115:Spta1 UTSW 1 174240357 missense probably damaging 1.00
R4303:Spta1 UTSW 1 174179852 missense probably damaging 1.00
R4419:Spta1 UTSW 1 174247424 nonsense probably null
R4525:Spta1 UTSW 1 174207110 missense probably null 1.00
R4614:Spta1 UTSW 1 174192977 missense probably damaging 1.00
R4673:Spta1 UTSW 1 174191062 splice site probably null
R4782:Spta1 UTSW 1 174230666 missense probably benign 0.01
R4825:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R4829:Spta1 UTSW 1 174237927 missense probably benign 0.01
R4873:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4875:Spta1 UTSW 1 174175830 missense probably damaging 1.00
R4898:Spta1 UTSW 1 174237834 missense possibly damaging 0.94
R4910:Spta1 UTSW 1 174217863 splice site probably null
R4911:Spta1 UTSW 1 174185647 missense probably damaging 1.00
R4928:Spta1 UTSW 1 174191056 missense probably benign 0.15
R4959:Spta1 UTSW 1 174246608 missense probably damaging 0.97
R5009:Spta1 UTSW 1 174240223 missense possibly damaging 0.62
R5149:Spta1 UTSW 1 174247434 missense probably damaging 0.99
R5293:Spta1 UTSW 1 174195985 missense probably damaging 0.99
R5421:Spta1 UTSW 1 174215529 missense probably damaging 0.99
R5457:Spta1 UTSW 1 174217193 missense probably damaging 1.00
R5590:Spta1 UTSW 1 174175770 missense possibly damaging 0.73
R5606:Spta1 UTSW 1 174219902 missense probably damaging 1.00
R5736:Spta1 UTSW 1 174214255 critical splice donor site probably null
R5834:Spta1 UTSW 1 174184797 intron probably null
R5845:Spta1 UTSW 1 174241096 missense probably damaging 0.97
R5987:Spta1 UTSW 1 174223328 missense probably damaging 1.00
R6102:Spta1 UTSW 1 174224520 missense probably benign 0.01
R6221:Spta1 UTSW 1 174181776 missense probably damaging 1.00
R6276:Spta1 UTSW 1 174218512 missense probably damaging 1.00
R6317:Spta1 UTSW 1 174241087 missense probably damaging 1.00
R6329:Spta1 UTSW 1 174214177 missense possibly damaging 0.60
R6352:Spta1 UTSW 1 174211646 missense possibly damaging 0.94
R6374:Spta1 UTSW 1 174214168 missense probably damaging 1.00
R6376:Spta1 UTSW 1 174203322 missense probably benign
R6387:Spta1 UTSW 1 174231333 missense probably benign 0.01
R6451:Spta1 UTSW 1 174217201 missense probably damaging 0.97
R6480:Spta1 UTSW 1 174187148 intron probably null
R6533:Spta1 UTSW 1 174244147 missense probably damaging 1.00
R6585:Spta1 UTSW 1 174178685 missense probably damaging 1.00
R6695:Spta1 UTSW 1 174244042 critical splice acceptor site probably null
R6945:Spta1 UTSW 1 174209325 missense possibly damaging 0.89
R7020:Spta1 UTSW 1 174209352 missense probably damaging 1.00
R7086:Spta1 UTSW 1 174199484 missense probably damaging 0.98
R7087:Spta1 UTSW 1 174174510 missense probably benign
R7151:Spta1 UTSW 1 174197751 missense probably damaging 1.00
R7193:Spta1 UTSW 1 174184612 missense probably damaging 1.00
R7199:Spta1 UTSW 1 174223271 missense possibly damaging 0.61
R7219:Spta1 UTSW 1 174222637 missense probably damaging 0.96
R7343:Spta1 UTSW 1 174223349 missense probably damaging 0.99
R7472:Spta1 UTSW 1 174246499 missense probably damaging 1.00
R7516:Spta1 UTSW 1 174197783 missense probably damaging 1.00
R7627:Spta1 UTSW 1 174205378 missense probably damaging 1.00
R7770:Spta1 UTSW 1 174195981 nonsense probably null
R7784:Spta1 UTSW 1 174202451 missense probably damaging 1.00
R7804:Spta1 UTSW 1 174195905 missense possibly damaging 0.50
RF002:Spta1 UTSW 1 174231360 missense possibly damaging 0.62
RF018:Spta1 UTSW 1 174209319 missense probably damaging 1.00
RF020:Spta1 UTSW 1 174213444 missense probably benign 0.42
RF020:Spta1 UTSW 1 174217903 missense probably damaging 1.00
T0722:Spta1 UTSW 1 174191066 splice site probably benign
X0028:Spta1 UTSW 1 174224450 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAATGCTACCAGAATTCTGC -3'
(R):5'- GGTTTCCTGATCACTTAAGAGGAATAC -3'

Sequencing Primer
(F):5'- GCTACCAGAATTCTGCTAACTTATG -3'
(R):5'- GGTATATGCACAGTGTTAATGTCTAG -3'
Posted On2019-09-13