Incidental Mutation 'R7372:Trim69'
ID572137
Institutional Source Beutler Lab
Gene Symbol Trim69
Ensembl Gene ENSMUSG00000033368
Gene Nametripartite motif-containing 69
Synonyms4921519C19Rik, Rnf36, Trif
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7372 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location122160700-122179027 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 122178583 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 375 (T375P)
Ref Sequence ENSEMBL: ENSMUSP00000047627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]
Predicted Effect probably benign
Transcript: ENSMUST00000028665
SMART Domains Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

DomainStartEndE-ValueType
low complexity region 33 41 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 215 227 N/A INTRINSIC
Pfam:PAT1 247 490 6.7e-12 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000036089
AA Change: T375P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: T375P

DomainStartEndE-ValueType
RING 42 82 8.48e-8 SMART
low complexity region 95 111 N/A INTRINSIC
PDB:4NQJ|C 144 322 2e-86 PDB
PRY 323 375 9.37e-19 SMART
SPRY 376 500 4.97e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cd209a T A 8: 3,748,857 probably null Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Crhr1 A G 11: 104,163,893 probably null Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Kif5c T A 2: 49,758,659 probably null Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tbc1d9b A G 11: 50,168,688 probably null Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Usp17lb A T 7: 104,841,706 probably null Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Trim69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00663:Trim69 APN 2 122167714 missense probably benign 0.00
IGL01321:Trim69 APN 2 122173284 missense possibly damaging 0.84
IGL01478:Trim69 APN 2 122178443 missense probably damaging 0.98
IGL01907:Trim69 APN 2 122167661 missense probably benign 0.00
IGL01925:Trim69 APN 2 122167916 missense probably damaging 1.00
IGL03065:Trim69 APN 2 122178634 missense probably damaging 0.98
IGL03121:Trim69 APN 2 122167647 missense probably benign 0.22
IGL03206:Trim69 APN 2 122173155 missense probably benign 0.00
R0019:Trim69 UTSW 2 122174477 splice site probably null
R0019:Trim69 UTSW 2 122174477 splice site probably null
R1956:Trim69 UTSW 2 122174475 critical splice donor site probably null
R1960:Trim69 UTSW 2 122167684 missense probably benign 0.00
R2212:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3412:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3414:Trim69 UTSW 2 122178644 missense probably benign 0.05
R3900:Trim69 UTSW 2 122178841 missense probably benign 0.03
R4470:Trim69 UTSW 2 122178599 missense probably damaging 1.00
R4950:Trim69 UTSW 2 122178746 missense probably damaging 1.00
R5045:Trim69 UTSW 2 122174246 missense probably benign 0.08
R5237:Trim69 UTSW 2 122173340 missense probably benign
R5931:Trim69 UTSW 2 122178594 missense probably damaging 0.98
R6483:Trim69 UTSW 2 122167600 nonsense probably null
R6872:Trim69 UTSW 2 122167910 missense probably damaging 1.00
R7451:Trim69 UTSW 2 122168027 missense probably benign 0.19
R7591:Trim69 UTSW 2 122167973 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ATTTTCGTACCAGGCCCATC -3'
(R):5'- CGCCCTCATAATCCAGGTAC -3'

Sequencing Primer
(F):5'- AGGCCCATCTCAATTAACTCTGG -3'
(R):5'- TGAGGTCGCCTAGAGTCAGACTAC -3'
Posted On2019-09-13