Mutagenetix > Incidental Mutations

Incidental Mutation 'R7372:Trim69'

572137

Institutional Source

Beutler Lab

Gene Symbol

Trim69

Ensembl Gene

ENSMUSG00000033368

Gene Name

tripartite motif-containing 69

Synonyms

4921519C19Rik, Rnf36, Trif

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.074) question?

Stock #

R7372 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

122160700-122179027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 122178583 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 375 (T375P)

Ref Sequence

ENSEMBL: ENSMUSP00000047627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028665] [ENSMUST00000036089]

Predicted Effect

probably benign
Transcript: ENSMUST00000028665

SMART Domains

Protein: ENSMUSP00000028665
Gene: ENSMUSG00000027233

Domain	Start	End	E-Value	Type
low complexity region	33	41	N/A	INTRINSIC
low complexity region	143	165	N/A	INTRINSIC
low complexity region	215	227	N/A	INTRINSIC
Pfam:PAT1	247	490	6.7e-12	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036089
AA Change: T375P

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000047627
Gene: ENSMUSG00000033368
AA Change: T375P

Domain	Start	End	E-Value	Type
RING	42	82	8.48e-8	SMART
low complexity region	95	111	N/A	INTRINSIC
PDB:4NQJ\|C	144	322	2e-86	PDB
PRY	323	375	9.37e-19	SMART
SPRY	376	500	4.97e-24	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING-B-box-coiled-coil (RBCC) family and encodes a protein with an N-terminal RING finger motif, a PRY domain and a C-terminal SPRY domain. The mouse ortholog of this gene is specifically expressed in germ cells at the round spermatid stages during spermatogenesis and, when overexpressed, induces apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	G	A	1: 156,622,619	V119M	probably damaging	Het
Acss2	T	C	2: 155,557,180	V454A	probably damaging	Het
Adam6b	T	A	12: 113,490,164	D200E	probably benign	Het
Adarb1	T	A	10: 77,295,878		probably null	Het
Aqp12	C	T	1: 93,006,366		probably benign	Het
Atrnl1	T	C	19: 57,935,646	V1281A	possibly damaging	Het
Brdt	A	G	5: 107,370,294	E761G	possibly damaging	Het
Bsn	A	T	9: 108,110,519	I2678N	unknown	Het
C2cd2	A	T	16: 97,875,380	C136S		Het
Camk4	A	G	18: 33,185,125	D445G	probably benign	Het
Cckar	T	C	5: 53,707,282	T26A	probably damaging	Het
Cd209a	T	A	8: 3,748,857		probably null	Het
Cept1	A	G	3: 106,503,740	F379S	probably benign	Het
Crhr1	A	G	11: 104,163,893		probably null	Het
Cryzl1	T	C	16: 91,712,197	E72G	probably benign	Het
Ctnnal1	T	A	4: 56,826,285	E526V	possibly damaging	Het
Cyp3a41a	T	C	5: 145,713,564	I90V	possibly damaging	Het
Dek	T	C	13: 47,105,577	E51G	unknown	Het
Evc2	T	A	5: 37,387,133	V742E	probably damaging	Het
Fat4	G	A	3: 38,890,209	V1084M	probably damaging	Het
Fscb	G	A	12: 64,471,824	T956I	unknown	Het
Glipr2	T	C	4: 43,968,184	L29P	probably damaging	Het
Gm19402	A	T	10: 77,690,427	S111T	unknown	Het
Gm340	T	C	19: 41,585,506	L900P	probably damaging	Het
Gm4553	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	7: 142,165,420		probably benign	Het
Gnl3	T	C	14: 31,016,886	K115E	probably benign	Het
Gpn1	T	A	5: 31,501,121	F147I	probably damaging	Het
Gsdmd	T	A	15: 75,865,769	L232H	probably benign	Het
Helz2	A	G	2: 181,238,423	V500A	possibly damaging	Het
Hemk1	T	C	9: 107,337,068	E55G	probably benign	Het
Hs2st1	A	T	3: 144,435,460		probably null	Het
Ighv1-63	A	G	12: 115,495,866	V37A	probably damaging	Het
Iqsec3	C	A	6: 121,384,032	E956*	probably null	Het
Kcnh8	T	A	17: 52,894,101	I521K	probably damaging	Het
Kif3c	T	A	12: 3,387,592	M531K	probably benign	Het
Kif5c	T	A	2: 49,758,659		probably null	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lrrc32	A	G	7: 98,499,807	D598G	probably benign	Het
Mug2	T	C	6: 122,083,466	V1387A	possibly damaging	Het
Nin	T	A	12: 70,056,029	E275V		Het
Olfr493	A	G	7: 108,346,496	F162L	probably benign	Het
Papolg	A	G	11: 23,866,439	I698T	probably benign	Het
Pcdhb20	A	G	18: 37,506,787	N789D	probably benign	Het
Pih1d3	A	T	1: 31,223,351	D138V	probably damaging	Het
Pik3cg	C	T	12: 32,197,197	M842I	probably damaging	Het
Pnn	T	A	12: 59,068,979	D135E	probably damaging	Het
Pold1	C	A	7: 44,543,423	R5L	possibly damaging	Het
Prl8a1	A	T	13: 27,574,106	F207I	probably damaging	Het
Prr11	A	G	11: 87,098,774	V257A	probably benign	Het
Prtg	C	T	9: 72,851,566	R401*	probably null	Het
Rasgrp1	A	G	2: 117,285,154	M651T	probably benign	Het
Ryr2	T	A	13: 11,680,999	H2994L	probably damaging	Het
Snx13	A	T	12: 35,078,951	I23L	probably benign	Het
Snx7	A	G	3: 117,782,351	L429P	probably damaging	Het
Spta1	C	T	1: 174,197,635	Q689*	probably null	Het
Spty2d1	T	C	7: 46,998,944	D79G	probably damaging	Het
Tbc1d9b	A	G	11: 50,168,688		probably null	Het
Tnxb	T	C	17: 34,717,254	F2722L	possibly damaging	Het
Tppp2	C	T	14: 51,919,408	R81C	probably benign	Het
Trim6	G	T	7: 104,232,636	A391S	probably benign	Het
Trim72	A	G	7: 128,004,686	N68S	possibly damaging	Het
Trrap	G	A	5: 144,789,398	V386I	probably benign	Het
Ttn	T	C	2: 76,947,931	I1371V	unknown	Het
Usp17lb	A	T	7: 104,841,706		probably null	Het
Vmn2r20	A	T	6: 123,385,509	L772Q	probably damaging	Het
Ypel3	A	G	7: 126,780,028	E91G	probably benign	Het
Zbtb21	C	T	16: 97,950,369	E905K	possibly damaging	Het
Zfp189	T	A	4: 49,530,417	C507S	possibly damaging	Het

Other mutations in Trim69

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00663:Trim69	APN	2	122167714	missense	probably benign	0.00
IGL01321:Trim69	APN	2	122173284	missense	possibly damaging	0.84
IGL01478:Trim69	APN	2	122178443	missense	probably damaging	0.98
IGL01907:Trim69	APN	2	122167661	missense	probably benign	0.00
IGL01925:Trim69	APN	2	122167916	missense	probably damaging	1.00
IGL03065:Trim69	APN	2	122178634	missense	probably damaging	0.98
IGL03121:Trim69	APN	2	122167647	missense	probably benign	0.22
IGL03206:Trim69	APN	2	122173155	missense	probably benign	0.00
R0019:Trim69	UTSW	2	122174477	splice site	probably null
R0019:Trim69	UTSW	2	122174477	splice site	probably null
R1956:Trim69	UTSW	2	122174475	critical splice donor site	probably null
R1960:Trim69	UTSW	2	122167684	missense	probably benign	0.00
R2212:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3412:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3414:Trim69	UTSW	2	122178644	missense	probably benign	0.05
R3900:Trim69	UTSW	2	122178841	missense	probably benign	0.03
R4470:Trim69	UTSW	2	122178599	missense	probably damaging	1.00
R4950:Trim69	UTSW	2	122178746	missense	probably damaging	1.00
R5045:Trim69	UTSW	2	122174246	missense	probably benign	0.08
R5237:Trim69	UTSW	2	122173340	missense	probably benign
R5931:Trim69	UTSW	2	122178594	missense	probably damaging	0.98
R6483:Trim69	UTSW	2	122167600	nonsense	probably null
R6872:Trim69	UTSW	2	122167910	missense	probably damaging	1.00
R7451:Trim69	UTSW	2	122168027	missense	probably benign	0.19
R7591:Trim69	UTSW	2	122167973	missense	probably benign	0.17
R8353:Trim69	UTSW	2	122168009	missense	possibly damaging	0.73
R8551:Trim69	UTSW	2	122173329	missense	probably benign	0.00
Z1176:Trim69	UTSW	2	122167554	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATTTTCGTACCAGGCCCATC -3'
(R):5'- CGCCCTCATAATCCAGGTAC -3'

Sequencing Primer
(F):5'- AGGCCCATCTCAATTAACTCTGG -3'
(R):5'- TGAGGTCGCCTAGAGTCAGACTAC -3'

Posted On

2019-09-13