Incidental Mutation 'R7372:Cept1'
ID572141
Institutional Source Beutler Lab
Gene Symbol Cept1
Ensembl Gene ENSMUSG00000040774
Gene Namecholine/ethanolaminephosphotransferase 1
Synonyms9930118K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7372 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location106502260-106547802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 106503740 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 379 (F379S)
Ref Sequence ENSEMBL: ENSMUSP00000037277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029508] [ENSMUST00000039153] [ENSMUST00000068301] [ENSMUST00000121231] [ENSMUST00000183271] [ENSMUST00000192438]
Predicted Effect probably benign
Transcript: ENSMUST00000029508
SMART Domains Protein: ENSMUSP00000029508
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
uDENN 47 139 4.15e-27 SMART
DENN 146 330 8.1e-71 SMART
dDENN 368 435 3.38e-18 SMART
low complexity region 447 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039153
AA Change: F379S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037277
Gene: ENSMUSG00000040774
AA Change: F379S

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 229 6.4e-23 PFAM
transmembrane domain 249 271 N/A INTRINSIC
transmembrane domain 281 303 N/A INTRINSIC
transmembrane domain 316 338 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000068301
AA Change: F379S

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065743
Gene: ENSMUSG00000040774
AA Change: F379S

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 328 3.2e-21 PFAM
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121231
AA Change: F379S

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000112509
Gene: ENSMUSG00000040774
AA Change: F379S

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 83 158 7.4e-18 PFAM
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 213 235 N/A INTRINSIC
transmembrane domain 248 270 N/A INTRINSIC
transmembrane domain 285 304 N/A INTRINSIC
transmembrane domain 317 339 N/A INTRINSIC
transmembrane domain 370 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183271
SMART Domains Protein: ENSMUSP00000138462
Gene: ENSMUSG00000027901

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
uDENN 57 149 4.15e-27 SMART
DENN 156 340 8.1e-71 SMART
dDENN 378 445 3.38e-18 SMART
low complexity region 457 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192438
SMART Domains Protein: ENSMUSP00000142097
Gene: ENSMUSG00000040774

DomainStartEndE-ValueType
Pfam:CDP-OH_P_transf 81 215 2.3e-20 PFAM
transmembrane domain 227 246 N/A INTRINSIC
Meta Mutation Damage Score 0.0893 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene codes for a choline/ethanolaminephosphotransferase, which functions in the synthesis of choline- or ethanolamine- containing phospholipids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Conditional homozygous knockout in skeletal muscle leads to improved glucose tolerance, increased insulin sensitivity and muscle weakness in mice fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cd209a T A 8: 3,748,857 probably null Het
Crhr1 A G 11: 104,163,893 probably null Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Kif5c T A 2: 49,758,659 probably null Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tbc1d9b A G 11: 50,168,688 probably null Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Usp17lb A T 7: 104,841,706 probably null Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Cept1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Cept1 APN 3 106505803 missense possibly damaging 0.95
IGL01860:Cept1 APN 3 106531128 intron probably benign
IGL02053:Cept1 APN 3 106533396 missense probably damaging 1.00
IGL02351:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02358:Cept1 APN 3 106539188 critical splice donor site probably null
IGL02568:Cept1 APN 3 106503719 missense probably benign 0.03
IGL02960:Cept1 APN 3 106539396 nonsense probably null
IGL03019:Cept1 APN 3 106504641 missense probably damaging 1.00
IGL03182:Cept1 APN 3 106504550 missense probably damaging 1.00
IGL03401:Cept1 APN 3 106533390 missense probably damaging 1.00
R2128:Cept1 UTSW 3 106512879 missense probably damaging 1.00
R2928:Cept1 UTSW 3 106531152 missense probably benign 0.07
R3688:Cept1 UTSW 3 106520015 missense probably benign 0.00
R4762:Cept1 UTSW 3 106539361 nonsense probably null
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4861:Cept1 UTSW 3 106505732 missense probably damaging 0.97
R4890:Cept1 UTSW 3 106505807 missense probably damaging 1.00
R5506:Cept1 UTSW 3 106531248 missense probably benign 0.00
R5999:Cept1 UTSW 3 106533443 missense probably damaging 1.00
R6106:Cept1 UTSW 3 106503676 missense probably benign 0.00
R6478:Cept1 UTSW 3 106533445 nonsense probably null
R6560:Cept1 UTSW 3 106505278 missense possibly damaging 0.84
R6858:Cept1 UTSW 3 106512879 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAGGACAGTTAGGGAGTGTTAC -3'
(R):5'- CCCTTAGTTAATAAAGGAGACACCAG -3'

Sequencing Primer
(F):5'- CAGTTAGGGAGTGTTACCAGTAAC -3'
(R):5'- GACACCAGGAGGCAATTGATTTACTC -3'
Posted On2019-09-13