Mutagenetix > Incidental Mutations

Incidental Mutation 'R7372:Brdt'

572150

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7372 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107370294 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 761 (E761G)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031215
AA Change: E761G

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: E761G

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abl2	G	A	1: 156,622,619	V119M	probably damaging	Het
Acss2	T	C	2: 155,557,180	V454A	probably damaging	Het
Adam6b	T	A	12: 113,490,164	D200E	probably benign	Het
Adarb1	T	A	10: 77,295,878		probably null	Het
Aqp12	C	T	1: 93,006,366		probably benign	Het
Atrnl1	T	C	19: 57,935,646	V1281A	possibly damaging	Het
Bsn	A	T	9: 108,110,519	I2678N	unknown	Het
C2cd2	A	T	16: 97,875,380	C136S		Het
Camk4	A	G	18: 33,185,125	D445G	probably benign	Het
Cckar	T	C	5: 53,707,282	T26A	probably damaging	Het
Cd209a	T	A	8: 3,748,857		probably null	Het
Cept1	A	G	3: 106,503,740	F379S	probably benign	Het
Crhr1	A	G	11: 104,163,893		probably null	Het
Cryzl1	T	C	16: 91,712,197	E72G	probably benign	Het
Ctnnal1	T	A	4: 56,826,285	E526V	possibly damaging	Het
Cyp3a41a	T	C	5: 145,713,564	I90V	possibly damaging	Het
Dek	T	C	13: 47,105,577	E51G	unknown	Het
Evc2	T	A	5: 37,387,133	V742E	probably damaging	Het
Fat4	G	A	3: 38,890,209	V1084M	probably damaging	Het
Fscb	G	A	12: 64,471,824	T956I	unknown	Het
Glipr2	T	C	4: 43,968,184	L29P	probably damaging	Het
Gm19402	A	T	10: 77,690,427	S111T	unknown	Het
Gm340	T	C	19: 41,585,506	L900P	probably damaging	Het
Gm4553	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC	7: 142,165,420		probably benign	Het
Gnl3	T	C	14: 31,016,886	K115E	probably benign	Het
Gpn1	T	A	5: 31,501,121	F147I	probably damaging	Het
Gsdmd	T	A	15: 75,865,769	L232H	probably benign	Het
Helz2	A	G	2: 181,238,423	V500A	possibly damaging	Het
Hemk1	T	C	9: 107,337,068	E55G	probably benign	Het
Hs2st1	A	T	3: 144,435,460		probably null	Het
Ighv1-63	A	G	12: 115,495,866	V37A	probably damaging	Het
Iqsec3	C	A	6: 121,384,032	E956*	probably null	Het
Kcnh8	T	A	17: 52,894,101	I521K	probably damaging	Het
Kif3c	T	A	12: 3,387,592	M531K	probably benign	Het
Kif5c	T	A	2: 49,758,659		probably null	Het
Krt15	A	T	11: 100,135,560	V100E	possibly damaging	Het
Lrrc32	A	G	7: 98,499,807	D598G	probably benign	Het
Mug2	T	C	6: 122,083,466	V1387A	possibly damaging	Het
Nin	T	A	12: 70,056,029	E275V		Het
Olfr493	A	G	7: 108,346,496	F162L	probably benign	Het
Papolg	A	G	11: 23,866,439	I698T	probably benign	Het
Pcdhb20	A	G	18: 37,506,787	N789D	probably benign	Het
Pih1d3	A	T	1: 31,223,351	D138V	probably damaging	Het
Pik3cg	C	T	12: 32,197,197	M842I	probably damaging	Het
Pnn	T	A	12: 59,068,979	D135E	probably damaging	Het
Pold1	C	A	7: 44,543,423	R5L	possibly damaging	Het
Prl8a1	A	T	13: 27,574,106	F207I	probably damaging	Het
Prr11	A	G	11: 87,098,774	V257A	probably benign	Het
Prtg	C	T	9: 72,851,566	R401*	probably null	Het
Rasgrp1	A	G	2: 117,285,154	M651T	probably benign	Het
Ryr2	T	A	13: 11,680,999	H2994L	probably damaging	Het
Snx13	A	T	12: 35,078,951	I23L	probably benign	Het
Snx7	A	G	3: 117,782,351	L429P	probably damaging	Het
Spta1	C	T	1: 174,197,635	Q689*	probably null	Het
Spty2d1	T	C	7: 46,998,944	D79G	probably damaging	Het
Tbc1d9b	A	G	11: 50,168,688		probably null	Het
Tnxb	T	C	17: 34,717,254	F2722L	possibly damaging	Het
Tppp2	C	T	14: 51,919,408	R81C	probably benign	Het
Trim6	G	T	7: 104,232,636	A391S	probably benign	Het
Trim69	A	C	2: 122,178,583	T375P	possibly damaging	Het
Trim72	A	G	7: 128,004,686	N68S	possibly damaging	Het
Trrap	G	A	5: 144,789,398	V386I	probably benign	Het
Ttn	T	C	2: 76,947,931	I1371V	unknown	Het
Usp17lb	A	T	7: 104,841,706		probably null	Het
Vmn2r20	A	T	6: 123,385,509	L772Q	probably damaging	Het
Ypel3	A	G	7: 126,780,028	E91G	probably benign	Het
Zbtb21	C	T	16: 97,950,369	E905K	possibly damaging	Het
Zfp189	T	A	4: 49,530,417	C507S	possibly damaging	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4258:Brdt	UTSW	5	107359909	missense	probably damaging	0.97
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- AGCATCGTTAGTCTGCTGCTTATG -3'
(R):5'- AAAGCAGTTTCCTGGGACC -3'

Sequencing Primer
(F):5'- TGTGTTCCAGATCTCTTAATTATGC -3'
(R):5'- GACCTGGCTCATTCAGTGATGC -3'

Posted On

2019-09-13