Incidental Mutation 'R7372:Cyp3a41a'
ID572152
Institutional Source Beutler Lab
Gene Symbol Cyp3a41a
Ensembl Gene ENSMUSG00000075551
Gene Namecytochrome P450, family 3, subfamily a, polypeptide 41A
Synonymssteroid inducible, Cyp3a41
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7372 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location145694049-145720136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145713564 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 90 (I90V)
Ref Sequence ENSEMBL: ENSMUSP00000091659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094111]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094111
AA Change: I90V

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000091659
Gene: ENSMUSG00000075551
AA Change: I90V

DomainStartEndE-ValueType
Pfam:p450 38 494 1.7e-136 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cd209a T A 8: 3,748,857 probably null Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Crhr1 A G 11: 104,163,893 probably null Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Kif5c T A 2: 49,758,659 probably null Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tbc1d9b A G 11: 50,168,688 probably null Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Usp17lb A T 7: 104,841,706 probably null Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Cyp3a41a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02284:Cyp3a41a APN 5 145704863 splice site probably benign
IGL03003:Cyp3a41a APN 5 145705830 missense probably benign
R0006:Cyp3a41a UTSW 5 145704796 missense probably benign 0.01
R0515:Cyp3a41a UTSW 5 145718000 missense probably damaging 1.00
R1052:Cyp3a41a UTSW 5 145705811 missense possibly damaging 0.49
R3708:Cyp3a41a UTSW 5 145717923 critical splice donor site probably null
R4049:Cyp3a41a UTSW 5 145713540 missense probably damaging 1.00
R4755:Cyp3a41a UTSW 5 145715506 missense probably damaging 1.00
R4975:Cyp3a41a UTSW 5 145720048 start codon destroyed probably null 1.00
R6519:Cyp3a41a UTSW 5 145715498 missense probably damaging 1.00
R6788:Cyp3a41a UTSW 5 145705829 missense probably benign 0.00
R7184:Cyp3a41a UTSW 5 145705853 missense probably benign 0.01
R7451:Cyp3a41a UTSW 5 145699740 missense probably benign 0.10
R7463:Cyp3a41a UTSW 5 145713564 missense probably damaging 1.00
R7766:Cyp3a41a UTSW 5 145718017 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTAATTGCAGCACACTTCCCG -3'
(R):5'- ACATGGTCAGAATTCCTAAGCTG -3'

Sequencing Primer
(F):5'- CCCGCTTTTCCTATATGTGTGTGTG -3'
(R):5'- TTCCTAAGCTGAACTGGGAACTC -3'
Posted On2019-09-13