Incidental Mutation 'R7372:Bsn'
ID572166
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R7372 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108110519 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2678 (I2678N)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect unknown
Transcript: ENSMUST00000035208
AA Change: I2678N
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: I2678N

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2113:Bsn UTSW 9 108114886 missense probably benign 0.14
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108108186 missense unknown
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTGGTCCTATGAGCTG -3'
(R):5'- GCAGACAGCAGTGTTCAGAC -3'

Sequencing Primer
(F):5'- TCCTATGAGCTGTGGCCCAG -3'
(R):5'- TACCTTGTGACTCGCAGGC -3'
Posted On2019-09-13