Incidental Mutation 'R7372:C2cd2'
ID572187
Institutional Source Beutler Lab
Gene Symbol C2cd2
Ensembl Gene ENSMUSG00000045975
Gene NameC2 calcium-dependent domain containing 2
SynonymsORF25, 5830404H04Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7372 (G1)
Quality Score128.008
Status Not validated
Chromosome16
Chromosomal Location97855209-97962598 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 97875380 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 136 (C136S)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170757]
Predicted Effect probably benign
Transcript: ENSMUST00000170757
SMART Domains Protein: ENSMUSP00000127368
Gene: ENSMUSG00000045975

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 106 122 N/A INTRINSIC
Pfam:C2 232 359 1.9e-6 PFAM
low complexity region 410 421 N/A INTRINSIC
low complexity region 491 517 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kcnh8 T A 17: 52,894,101 I521K probably damaging Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in C2cd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:C2cd2 APN 16 97870220 missense probably damaging 1.00
IGL01633:C2cd2 APN 16 97875123 splice site probably benign
IGL01731:C2cd2 APN 16 97870172 missense probably damaging 1.00
IGL02071:C2cd2 APN 16 97870232 missense probably damaging 1.00
IGL02086:C2cd2 APN 16 97890008 splice site probably benign
IGL02502:C2cd2 APN 16 97876390 missense possibly damaging 0.85
IGL02933:C2cd2 APN 16 97892201 missense probably benign 0.22
IGL03005:C2cd2 APN 16 97859432 missense probably damaging 0.99
IGL03493:C2cd2 APN 16 97881661 missense probably damaging 0.97
H8562:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
H8786:C2cd2 UTSW 16 97879640 missense possibly damaging 0.91
R0480:C2cd2 UTSW 16 97877148 missense probably benign 0.45
R0483:C2cd2 UTSW 16 97859588 splice site probably benign
R0541:C2cd2 UTSW 16 97922296 missense possibly damaging 0.66
R1294:C2cd2 UTSW 16 97922269 missense probably damaging 1.00
R1986:C2cd2 UTSW 16 97870271 missense probably damaging 1.00
R2518:C2cd2 UTSW 16 97922086 missense probably benign 0.01
R5468:C2cd2 UTSW 16 97868591 unclassified probably null
R5507:C2cd2 UTSW 16 97881620 missense probably benign 0.01
R5979:C2cd2 UTSW 16 97875218 missense probably benign 0.01
R6466:C2cd2 UTSW 16 97879622 missense probably benign
R7264:C2cd2 UTSW 16 97876219 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCTGGACAGAGATGTC -3'
(R):5'- CAGCACAAACCTTTCTTTTGCATTG -3'

Sequencing Primer
(F):5'- GACAGAGATGTCCTTCTCAATGAC -3'
(R):5'- TGCATTGTAGCTAGCCCCTGG -3'
Posted On2019-09-13