Incidental Mutation 'R7372:Kcnh8'
ID572190
Institutional Source Beutler Lab
Gene Symbol Kcnh8
Ensembl Gene ENSMUSG00000035580
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 8
SynonymsELK1, C130090D05Rik, Kv12.1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7372 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location52602709-52979194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52894101 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 521 (I521K)
Ref Sequence ENSEMBL: ENSMUSP00000049206 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039366]
Predicted Effect probably damaging
Transcript: ENSMUST00000039366
AA Change: I521K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049206
Gene: ENSMUSG00000035580
AA Change: I521K

DomainStartEndE-ValueType
Blast:PAS 16 88 9e-35 BLAST
PAC 94 136 3.42e-9 SMART
Pfam:Ion_trans 221 481 4.9e-36 PFAM
Pfam:Ion_trans_2 411 475 1.1e-12 PFAM
cNMP 551 666 1.17e-16 SMART
low complexity region 710 722 N/A INTRINSIC
coiled coil region 853 897 N/A INTRINSIC
low complexity region 1020 1036 N/A INTRINSIC
Meta Mutation Damage Score 0.9441 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl2 G A 1: 156,622,619 V119M probably damaging Het
Acss2 T C 2: 155,557,180 V454A probably damaging Het
Adam6b T A 12: 113,490,164 D200E probably benign Het
Adarb1 T A 10: 77,295,878 probably null Het
Aqp12 C T 1: 93,006,366 probably benign Het
Atrnl1 T C 19: 57,935,646 V1281A possibly damaging Het
Brdt A G 5: 107,370,294 E761G possibly damaging Het
Bsn A T 9: 108,110,519 I2678N unknown Het
C2cd2 A T 16: 97,875,380 C136S Het
Camk4 A G 18: 33,185,125 D445G probably benign Het
Cckar T C 5: 53,707,282 T26A probably damaging Het
Cd209a T A 8: 3,748,857 probably null Het
Cept1 A G 3: 106,503,740 F379S probably benign Het
Crhr1 A G 11: 104,163,893 probably null Het
Cryzl1 T C 16: 91,712,197 E72G probably benign Het
Ctnnal1 T A 4: 56,826,285 E526V possibly damaging Het
Cyp3a41a T C 5: 145,713,564 I90V possibly damaging Het
Dek T C 13: 47,105,577 E51G unknown Het
Evc2 T A 5: 37,387,133 V742E probably damaging Het
Fat4 G A 3: 38,890,209 V1084M probably damaging Het
Fscb G A 12: 64,471,824 T956I unknown Het
Glipr2 T C 4: 43,968,184 L29P probably damaging Het
Gm19402 A T 10: 77,690,427 S111T unknown Het
Gm340 T C 19: 41,585,506 L900P probably damaging Het
Gm4553 ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC ACCCTTGCAGCCACCACAGGAGCCACAGCCCCCACAGGAGCTACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCC 7: 142,165,420 probably benign Het
Gnl3 T C 14: 31,016,886 K115E probably benign Het
Gpn1 T A 5: 31,501,121 F147I probably damaging Het
Gsdmd T A 15: 75,865,769 L232H probably benign Het
Helz2 A G 2: 181,238,423 V500A possibly damaging Het
Hemk1 T C 9: 107,337,068 E55G probably benign Het
Hs2st1 A T 3: 144,435,460 probably null Het
Ighv1-63 A G 12: 115,495,866 V37A probably damaging Het
Iqsec3 C A 6: 121,384,032 E956* probably null Het
Kif3c T A 12: 3,387,592 M531K probably benign Het
Kif5c T A 2: 49,758,659 probably null Het
Krt15 A T 11: 100,135,560 V100E possibly damaging Het
Lrrc32 A G 7: 98,499,807 D598G probably benign Het
Mug2 T C 6: 122,083,466 V1387A possibly damaging Het
Nin T A 12: 70,056,029 E275V Het
Olfr493 A G 7: 108,346,496 F162L probably benign Het
Papolg A G 11: 23,866,439 I698T probably benign Het
Pcdhb20 A G 18: 37,506,787 N789D probably benign Het
Pih1d3 A T 1: 31,223,351 D138V probably damaging Het
Pik3cg C T 12: 32,197,197 M842I probably damaging Het
Pnn T A 12: 59,068,979 D135E probably damaging Het
Pold1 C A 7: 44,543,423 R5L possibly damaging Het
Prl8a1 A T 13: 27,574,106 F207I probably damaging Het
Prr11 A G 11: 87,098,774 V257A probably benign Het
Prtg C T 9: 72,851,566 R401* probably null Het
Rasgrp1 A G 2: 117,285,154 M651T probably benign Het
Ryr2 T A 13: 11,680,999 H2994L probably damaging Het
Snx13 A T 12: 35,078,951 I23L probably benign Het
Snx7 A G 3: 117,782,351 L429P probably damaging Het
Spta1 C T 1: 174,197,635 Q689* probably null Het
Spty2d1 T C 7: 46,998,944 D79G probably damaging Het
Tbc1d9b A G 11: 50,168,688 probably null Het
Tnxb T C 17: 34,717,254 F2722L possibly damaging Het
Tppp2 C T 14: 51,919,408 R81C probably benign Het
Trim6 G T 7: 104,232,636 A391S probably benign Het
Trim69 A C 2: 122,178,583 T375P possibly damaging Het
Trim72 A G 7: 128,004,686 N68S possibly damaging Het
Trrap G A 5: 144,789,398 V386I probably benign Het
Ttn T C 2: 76,947,931 I1371V unknown Het
Usp17lb A T 7: 104,841,706 probably null Het
Vmn2r20 A T 6: 123,385,509 L772Q probably damaging Het
Ypel3 A G 7: 126,780,028 E91G probably benign Het
Zbtb21 C T 16: 97,950,369 E905K possibly damaging Het
Zfp189 T A 4: 49,530,417 C507S possibly damaging Het
Other mutations in Kcnh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Kcnh8 APN 17 52834680 missense probably damaging 1.00
IGL01901:Kcnh8 APN 17 52894120 splice site probably benign
IGL01959:Kcnh8 APN 17 52834607 missense probably damaging 1.00
IGL02214:Kcnh8 APN 17 52877911 missense possibly damaging 0.88
IGL02528:Kcnh8 APN 17 52803528 missense probably damaging 1.00
IGL02620:Kcnh8 APN 17 52898497 missense probably damaging 0.99
IGL02688:Kcnh8 APN 17 52959443 missense probably benign 0.00
IGL02931:Kcnh8 APN 17 52956622 missense probably benign 0.00
IGL02950:Kcnh8 APN 17 52956767 missense probably benign 0.22
Incompetent UTSW 17 52894101 missense probably damaging 1.00
leak UTSW 17 52725906 small deletion probably benign
R0282:Kcnh8 UTSW 17 52725851 missense probably damaging 1.00
R0448:Kcnh8 UTSW 17 52977620 splice site probably null
R0496:Kcnh8 UTSW 17 52725858 missense probably benign 0.19
R0601:Kcnh8 UTSW 17 52894005 missense probably damaging 1.00
R0671:Kcnh8 UTSW 17 52978113 nonsense probably null
R0891:Kcnh8 UTSW 17 52905214 missense probably damaging 1.00
R0971:Kcnh8 UTSW 17 52725899 missense probably benign 0.00
R1054:Kcnh8 UTSW 17 52803484 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893960 missense probably damaging 1.00
R1237:Kcnh8 UTSW 17 52893961 missense probably damaging 1.00
R1565:Kcnh8 UTSW 17 52956881 missense probably benign
R1657:Kcnh8 UTSW 17 52839125 missense probably damaging 1.00
R1669:Kcnh8 UTSW 17 52893968 missense probably damaging 1.00
R1786:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R1803:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1804:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1929:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1980:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1981:Kcnh8 UTSW 17 52725906 small deletion probably benign
R1982:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2016:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2017:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2132:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2133:Kcnh8 UTSW 17 52893933 missense probably damaging 1.00
R2208:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2265:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2266:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2267:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2303:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2309:Kcnh8 UTSW 17 52978039 missense probably damaging 1.00
R2760:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2764:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2857:Kcnh8 UTSW 17 52977933 missense probably benign
R2898:Kcnh8 UTSW 17 52725906 small deletion probably benign
R2987:Kcnh8 UTSW 17 52956735 missense probably benign 0.05
R3031:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3157:Kcnh8 UTSW 17 52725906 small deletion probably benign
R3158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4080:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4081:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4082:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4087:Kcnh8 UTSW 17 52803400 missense possibly damaging 0.93
R4132:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4158:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4213:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4301:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4302:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4383:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4385:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4400:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4490:Kcnh8 UTSW 17 52961877 critical splice donor site probably null
R4493:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4494:Kcnh8 UTSW 17 52725906 small deletion probably benign
R4611:Kcnh8 UTSW 17 52602836 missense probably benign 0.22
R4728:Kcnh8 UTSW 17 52725870 missense probably damaging 1.00
R4810:Kcnh8 UTSW 17 52905220 splice site probably null
R4927:Kcnh8 UTSW 17 52877981 missense probably damaging 1.00
R4984:Kcnh8 UTSW 17 52877967 missense probably damaging 1.00
R5017:Kcnh8 UTSW 17 52893930 missense probably damaging 1.00
R5214:Kcnh8 UTSW 17 52898458 missense probably damaging 1.00
R5272:Kcnh8 UTSW 17 52905015 missense probably damaging 0.97
R5386:Kcnh8 UTSW 17 52725995 missense probably benign 0.10
R5472:Kcnh8 UTSW 17 52977816 missense possibly damaging 0.71
R5500:Kcnh8 UTSW 17 52725980 missense probably benign 0.00
R5714:Kcnh8 UTSW 17 52978122 missense probably benign 0.31
R5866:Kcnh8 UTSW 17 52956776 missense probably benign 0.05
R5903:Kcnh8 UTSW 17 52803336 missense possibly damaging 0.87
R6969:Kcnh8 UTSW 17 52877943 nonsense probably null
R6994:Kcnh8 UTSW 17 52977695 missense probably benign 0.02
R7101:Kcnh8 UTSW 17 52905010 missense probably damaging 1.00
R7189:Kcnh8 UTSW 17 52894117 splice site probably null
R7228:Kcnh8 UTSW 17 52956716 missense probably benign 0.01
R7751:Kcnh8 UTSW 17 52961843 missense probably damaging 1.00
R7819:Kcnh8 UTSW 17 52956715 missense probably benign
RF009:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF010:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF011:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF021:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
RF022:Kcnh8 UTSW 17 52978239 missense probably benign 0.00
Z1088:Kcnh8 UTSW 17 52725890 missense probably damaging 1.00
Z1088:Kcnh8 UTSW 17 52978292 missense probably benign
Z1176:Kcnh8 UTSW 17 52894061 missense probably damaging 0.98
Z1177:Kcnh8 UTSW 17 52803471 missense probably damaging 1.00
Z1177:Kcnh8 UTSW 17 52978093 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AGTATTTGGGAACGTGACTGCC -3'
(R):5'- CATTGTGAAGACATGTAGTGACAC -3'

Sequencing Primer
(F):5'- TGGGAACGTGACTGCCATCATAC -3'
(R):5'- GTTTGCCAACCAGGTAGCATACATG -3'
Posted On2019-09-13