Incidental Mutation 'R7373:Olfr1311'
ID572202
Institutional Source Beutler Lab
Gene Symbol Olfr1311
Ensembl Gene ENSMUSG00000109403
Gene Nameolfactory receptor 1311
SynonymsGA_x6K02T2Q125-73069292-73068354, MOR245-21
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R7373 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location112019656-112024412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112021442 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 137 (R137S)
Ref Sequence ENSEMBL: ENSMUSP00000151010 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000208536
AA Change: R137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213602
AA Change: R137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000215321
AA Change: R137S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,795,435 A1027T probably benign Het
Aldh7a1 G A 18: 56,542,317 T260M possibly damaging Het
Anks3 T C 16: 4,955,871 Y187C probably benign Het
Atp2c2 A T 8: 119,730,252 I198F probably benign Het
Bsn T C 9: 108,113,484 T1690A probably damaging Het
Catsper3 T C 13: 55,808,132 I350T possibly damaging Het
Cdcp1 C T 9: 123,177,900 R594H probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldn1 G T 16: 26,360,856 P154T probably damaging Het
Cntnap5a A T 1: 116,580,637 N1293I probably benign Het
Cpsf4l C T 11: 113,699,831 probably null Het
Crybg1 T C 10: 44,004,140 T351A probably benign Het
Csmd1 T C 8: 15,992,713 N2340S probably damaging Het
Dennd4a C A 9: 64,897,269 Q1297K probably benign Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnah8 T C 17: 30,767,965 probably null Het
Dst G T 1: 34,188,391 L1688F probably benign Het
Ehmt1 A G 2: 24,919,573 M1T probably null Het
Fasn A T 11: 120,813,976 L1261Q possibly damaging Het
Fat1 A G 8: 45,026,665 D2916G probably damaging Het
Fgfr3 C A 5: 33,727,690 F49L probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hormad1 A T 3: 95,576,317 T147S probably damaging Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Itgb8 A G 12: 119,202,475 V107A probably benign Het
Kat2a C T 11: 100,708,566 A533T probably benign Het
Kif20b T C 19: 34,935,671 L328P probably damaging Het
Lims1 T C 10: 58,409,620 F157S probably damaging Het
Lrp2 G T 2: 69,500,692 H1673Q probably damaging Het
Lrrc46 C A 11: 97,038,880 M43I probably benign Het
Lrrk2 T C 15: 91,700,004 probably null Het
Meox2 A T 12: 37,108,798 probably benign Het
Mff A G 1: 82,737,117 probably null Het
Mfsd5 T A 15: 102,280,992 F266L probably damaging Het
Miga2 A G 2: 30,382,071 T468A probably damaging Het
Mmel1 T A 4: 154,889,208 L316Q not run Het
Ndufa9 C A 6: 126,834,458 G232C probably damaging Het
Obox2 A T 7: 15,397,220 K84* probably null Het
Olfr33 T A 7: 102,714,099 I105F possibly damaging Het
Otogl G T 10: 107,901,251 Q101K probably damaging Het
Pcnx2 C T 8: 125,808,027 V1288M probably damaging Het
Pde10a T A 17: 8,942,992 W220R probably benign Het
Recql5 T C 11: 115,928,372 T123A possibly damaging Het
Rpl28 T C 7: 4,793,603 V61A probably benign Het
Secisbp2l A T 2: 125,757,271 M494K probably damaging Het
Sh3bgr G A 16: 96,205,835 E2K unknown Het
Shcbp1l C A 1: 153,425,240 T6K probably benign Het
Slc22a15 A C 3: 101,877,897 L353R possibly damaging Het
Sqle T C 15: 59,317,809 I100T probably benign Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tll1 A T 8: 64,051,357 N668K probably damaging Het
Tm7sf2 A G 19: 6,066,646 S118P probably benign Het
Tmco5 G T 2: 116,886,745 V169L probably benign Het
Trpv1 A G 11: 73,240,673 K346E probably damaging Het
Ttk G A 9: 83,854,877 R463H probably benign Het
Vmn2r120 G T 17: 57,509,406 L650I probably benign Het
Vmn2r58 C T 7: 41,837,788 C561Y probably damaging Het
Vmn2r-ps117 A T 17: 18,824,686 Q455L probably benign Het
Zfr T A 15: 12,140,559 S231T unknown Het
Other mutations in Olfr1311
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Olfr1311 APN 2 112021132 missense probably damaging 1.00
IGL02626:Olfr1311 APN 2 112021113 missense probably damaging 1.00
R0499:Olfr1311 UTSW 2 112021432 missense probably damaging 1.00
R1511:Olfr1311 UTSW 2 112021404 missense probably benign 0.00
R3439:Olfr1311 UTSW 2 112021447 missense possibly damaging 0.95
R4564:Olfr1311 UTSW 2 112021767 missense possibly damaging 0.80
R4756:Olfr1311 UTSW 2 112020987 missense possibly damaging 0.52
R4776:Olfr1311 UTSW 2 112020931 missense probably benign 0.01
R5777:Olfr1311 UTSW 2 112021531 missense probably damaging 1.00
R5936:Olfr1311 UTSW 2 112021587 missense probably benign 0.38
R6283:Olfr1311 UTSW 2 112021260 missense possibly damaging 0.91
R6368:Olfr1311 UTSW 2 112021551 missense probably damaging 0.99
R6484:Olfr1311 UTSW 2 112021419 nonsense probably null
X0065:Olfr1311 UTSW 2 112021635 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGATGAGTCCACTGTTGGC -3'
(R):5'- GCTCTATTGCAGCACCCAAG -3'

Sequencing Primer
(F):5'- TTGGCTGTGACCATGAACAC -3'
(R):5'- GCAGCACCCAAGATGATTTTTGAC -3'
Posted On2019-09-13