Incidental Mutation 'R7373:Slc22a15'
ID572206
Institutional Source Beutler Lab
Gene Symbol Slc22a15
Ensembl Gene ENSMUSG00000033147
Gene Namesolute carrier family 22 (organic anion/cation transporter), member 15
SynonymsA530052I06Rik, 2610034P21Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R7373 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location101855776-101924453 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 101877897 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 353 (L353R)
Ref Sequence ENSEMBL: ENSMUSP00000102541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106928] [ENSMUST00000183255] [ENSMUST00000190824]
Predicted Effect possibly damaging
Transcript: ENSMUST00000106928
AA Change: L353R

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102541
Gene: ENSMUSG00000033147
AA Change: L353R

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 58 495 6.9e-29 PFAM
Pfam:MFS_1 69 450 3.4e-24 PFAM
low complexity region 524 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183255
SMART Domains Protein: ENSMUSP00000138357
Gene: ENSMUSG00000033147

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 56 244 5.2e-13 PFAM
Pfam:MFS_1 69 244 7.6e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000190824
AA Change: L198R

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000139518
Gene: ENSMUSG00000033147
AA Change: L198R

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
Pfam:Sugar_tr 88 341 3.3e-5 PFAM
low complexity region 369 377 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Organic ion transporters, such as SLC22A15, transport various medically and physiologically important compounds, including pharmaceuticals, toxins, hormones, neurotransmitters, and cellular metabolites. These transporters are also referred to as amphiphilic solute facilitators (ASFs).[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,795,435 A1027T probably benign Het
Aldh7a1 G A 18: 56,542,317 T260M possibly damaging Het
Anks3 T C 16: 4,955,871 Y187C probably benign Het
Atp2c2 A T 8: 119,730,252 I198F probably benign Het
Bsn T C 9: 108,113,484 T1690A probably damaging Het
Catsper3 T C 13: 55,808,132 I350T possibly damaging Het
Cdcp1 C T 9: 123,177,900 R594H probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cldn1 G T 16: 26,360,856 P154T probably damaging Het
Cntnap5a A T 1: 116,580,637 N1293I probably benign Het
Crybg1 T C 10: 44,004,140 T351A probably benign Het
Csmd1 T C 8: 15,992,713 N2340S probably damaging Het
Dennd4a C A 9: 64,897,269 Q1297K probably benign Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnah8 T C 17: 30,767,965 probably null Het
Dst G T 1: 34,188,391 L1688F probably benign Het
Ehmt1 A G 2: 24,919,573 M1T probably null Het
Fasn A T 11: 120,813,976 L1261Q possibly damaging Het
Fat1 A G 8: 45,026,665 D2916G probably damaging Het
Fgfr3 C A 5: 33,727,690 F49L probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hormad1 A T 3: 95,576,317 T147S probably damaging Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Itgb8 A G 12: 119,202,475 V107A probably benign Het
Kat2a C T 11: 100,708,566 A533T probably benign Het
Kif20b T C 19: 34,935,671 L328P probably damaging Het
Lims1 T C 10: 58,409,620 F157S probably damaging Het
Lrp2 G T 2: 69,500,692 H1673Q probably damaging Het
Lrrc46 C A 11: 97,038,880 M43I probably benign Het
Lrrk2 T C 15: 91,700,004 probably null Het
Meox2 A T 12: 37,108,798 probably benign Het
Mfsd5 T A 15: 102,280,992 F266L probably damaging Het
Miga2 A G 2: 30,382,071 T468A probably damaging Het
Mmel1 T A 4: 154,889,208 L316Q not run Het
Ndufa9 C A 6: 126,834,458 G232C probably damaging Het
Obox2 A T 7: 15,397,220 K84* probably null Het
Olfr1311 T A 2: 112,021,442 R137S probably benign Het
Olfr33 T A 7: 102,714,099 I105F possibly damaging Het
Otogl G T 10: 107,901,251 Q101K probably damaging Het
Pcnx2 C T 8: 125,808,027 V1288M probably damaging Het
Pde10a T A 17: 8,942,992 W220R probably benign Het
Recql5 T C 11: 115,928,372 T123A possibly damaging Het
Rpl28 T C 7: 4,793,603 V61A probably benign Het
Secisbp2l A T 2: 125,757,271 M494K probably damaging Het
Sh3bgr G A 16: 96,205,835 E2K unknown Het
Shcbp1l C A 1: 153,425,240 T6K probably benign Het
Sqle T C 15: 59,317,809 I100T probably benign Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tll1 A T 8: 64,051,357 N668K probably damaging Het
Tm7sf2 A G 19: 6,066,646 S118P probably benign Het
Tmco5 G T 2: 116,886,745 V169L probably benign Het
Trpv1 A G 11: 73,240,673 K346E probably damaging Het
Ttk G A 9: 83,854,877 R463H probably benign Het
Vmn2r120 G T 17: 57,509,406 L650I probably benign Het
Vmn2r58 C T 7: 41,837,788 C561Y probably damaging Het
Vmn2r-ps117 A T 17: 18,824,686 Q455L probably benign Het
Zfr T A 15: 12,140,559 S231T unknown Het
Other mutations in Slc22a15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Slc22a15 APN 3 101860820 missense probably benign 0.00
IGL01120:Slc22a15 APN 3 101897166 missense probably damaging 1.00
IGL01345:Slc22a15 APN 3 101880176 missense probably benign 0.00
IGL01871:Slc22a15 APN 3 101860794 splice site probably benign
IGL01880:Slc22a15 APN 3 101860848 missense probably benign 0.32
R0310:Slc22a15 UTSW 3 101860511 missense probably benign 0.12
R1758:Slc22a15 UTSW 3 101860453 nonsense probably null
R1937:Slc22a15 UTSW 3 101880189 critical splice acceptor site probably null
R3804:Slc22a15 UTSW 3 101897274 missense probably damaging 1.00
R4830:Slc22a15 UTSW 3 101875603 intron probably benign
R5564:Slc22a15 UTSW 3 101864589 missense probably benign 0.34
R5684:Slc22a15 UTSW 3 101862955 missense probably damaging 1.00
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6034:Slc22a15 UTSW 3 101862919 missense possibly damaging 0.80
R6114:Slc22a15 UTSW 3 101860852 nonsense probably null
R6481:Slc22a15 UTSW 3 101883583 missense possibly damaging 0.88
R6641:Slc22a15 UTSW 3 101875706 missense possibly damaging 0.52
R6945:Slc22a15 UTSW 3 101924114 missense probably damaging 0.99
R7354:Slc22a15 UTSW 3 101864581 missense probably benign 0.09
R7431:Slc22a15 UTSW 3 101897940 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTAGCCGCATTTAGCCTGAG -3'
(R):5'- TCAAATGGGTTAGTAGTGCTGC -3'

Sequencing Primer
(F):5'- TTAGCCTGAGAAAAACTCTGCTGG -3'
(R):5'- CTCTCATGGAAAAGTGTTGTTCC -3'
Posted On2019-09-13