Incidental Mutation 'R7373:Igf1r'
ID572216
Institutional Source Beutler Lab
Gene Symbol Igf1r
Ensembl Gene ENSMUSG00000005533
Gene Nameinsulin-like growth factor I receptor
Synonymsline 186, A330103N21Rik, CD221, hyft, IGF-1R
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7373 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location67952827-68233668 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 68195078 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 866 (Y866*)
Ref Sequence ENSEMBL: ENSMUSP00000005671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005671]
Predicted Effect probably null
Transcript: ENSMUST00000005671
AA Change: Y866*
SMART Domains Protein: ENSMUSP00000005671
Gene: ENSMUSG00000005533
AA Change: Y866*

DomainStartEndE-ValueType
Pfam:Recep_L_domain 51 161 1.6e-29 PFAM
FU 227 270 2.98e-12 SMART
Pfam:Recep_L_domain 353 467 3.8e-32 PFAM
FN3 490 593 4.67e-2 SMART
FN3 612 815 1.95e-4 SMART
FN3 833 915 7.4e-5 SMART
low complexity region 937 954 N/A INTRINSIC
TyrKc 1000 1268 8.51e-141 SMART
low complexity region 1285 1303 N/A INTRINSIC
low complexity region 1306 1319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208348
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This receptor binds insulin-like growth factor with a high affinity. It has tyrosine kinase activity. The insulin-like growth factor I receptor plays a critical role in transformation events. Cleavage of the precursor generates alpha and beta subunits. It is highly overexpressed in most malignant tissues where it functions as an anti-apoptotic agent by enhancing cell survival. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, May 2014]
PHENOTYPE: Targeted null mutants die at birth of respiratory failure; fetuses exhibit retarded growth, organ hypoplasia, ossification delay and nervous system and epidermal abnormalities. hyft homozygous fetuses are growth retarded and exhibit hydrops fetalis and focal hepatic ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,795,435 A1027T probably benign Het
Aldh7a1 G A 18: 56,542,317 T260M possibly damaging Het
Anks3 T C 16: 4,955,871 Y187C probably benign Het
Atp2c2 A T 8: 119,730,252 I198F probably benign Het
Bsn T C 9: 108,113,484 T1690A probably damaging Het
Catsper3 T C 13: 55,808,132 I350T possibly damaging Het
Cdcp1 C T 9: 123,177,900 R594H probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cldn1 G T 16: 26,360,856 P154T probably damaging Het
Cntnap5a A T 1: 116,580,637 N1293I probably benign Het
Cpsf4l C T 11: 113,699,831 probably null Het
Crybg1 T C 10: 44,004,140 T351A probably benign Het
Csmd1 T C 8: 15,992,713 N2340S probably damaging Het
Dennd4a C A 9: 64,897,269 Q1297K probably benign Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnah8 T C 17: 30,767,965 probably null Het
Dst G T 1: 34,188,391 L1688F probably benign Het
Ehmt1 A G 2: 24,919,573 M1T probably null Het
Fasn A T 11: 120,813,976 L1261Q possibly damaging Het
Fat1 A G 8: 45,026,665 D2916G probably damaging Het
Fgfr3 C A 5: 33,727,690 F49L probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hormad1 A T 3: 95,576,317 T147S probably damaging Het
Itgb8 A G 12: 119,202,475 V107A probably benign Het
Kat2a C T 11: 100,708,566 A533T probably benign Het
Kif20b T C 19: 34,935,671 L328P probably damaging Het
Lims1 T C 10: 58,409,620 F157S probably damaging Het
Lrp2 G T 2: 69,500,692 H1673Q probably damaging Het
Lrrc46 C A 11: 97,038,880 M43I probably benign Het
Lrrk2 T C 15: 91,700,004 probably null Het
Meox2 A T 12: 37,108,798 probably benign Het
Mff A G 1: 82,737,117 probably null Het
Mfsd5 T A 15: 102,280,992 F266L probably damaging Het
Miga2 A G 2: 30,382,071 T468A probably damaging Het
Mmel1 T A 4: 154,889,208 L316Q not run Het
Ndufa9 C A 6: 126,834,458 G232C probably damaging Het
Obox2 A T 7: 15,397,220 K84* probably null Het
Olfr1311 T A 2: 112,021,442 R137S probably benign Het
Olfr33 T A 7: 102,714,099 I105F possibly damaging Het
Otogl G T 10: 107,901,251 Q101K probably damaging Het
Pcnx2 C T 8: 125,808,027 V1288M probably damaging Het
Pde10a T A 17: 8,942,992 W220R probably benign Het
Recql5 T C 11: 115,928,372 T123A possibly damaging Het
Rpl28 T C 7: 4,793,603 V61A probably benign Het
Secisbp2l A T 2: 125,757,271 M494K probably damaging Het
Sh3bgr G A 16: 96,205,835 E2K unknown Het
Shcbp1l C A 1: 153,425,240 T6K probably benign Het
Slc22a15 A C 3: 101,877,897 L353R possibly damaging Het
Sqle T C 15: 59,317,809 I100T probably benign Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tll1 A T 8: 64,051,357 N668K probably damaging Het
Tm7sf2 A G 19: 6,066,646 S118P probably benign Het
Tmco5 G T 2: 116,886,745 V169L probably benign Het
Trpv1 A G 11: 73,240,673 K346E probably damaging Het
Ttk G A 9: 83,854,877 R463H probably benign Het
Vmn2r120 G T 17: 57,509,406 L650I probably benign Het
Vmn2r58 C T 7: 41,837,788 C561Y probably damaging Het
Vmn2r-ps117 A T 17: 18,824,686 Q455L probably benign Het
Zfr T A 15: 12,140,559 S231T unknown Het
Other mutations in Igf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Igf1r APN 7 68190023 missense probably benign
IGL00837:Igf1r APN 7 68201352 splice site probably benign
IGL01515:Igf1r APN 7 68207452 missense probably damaging 1.00
IGL01572:Igf1r APN 7 68193441 missense probably benign 0.01
IGL02100:Igf1r APN 7 68189958 missense probably benign 0.05
IGL02506:Igf1r APN 7 68193396 missense probably benign
IGL02672:Igf1r APN 7 68190033 missense probably benign 0.05
IGL02701:Igf1r APN 7 68201249 missense possibly damaging 0.93
IGL02742:Igf1r APN 7 68189991 missense possibly damaging 0.94
IGL03073:Igf1r APN 7 68215043 missense probably damaging 1.00
IGL03257:Igf1r APN 7 68214940 missense probably damaging 1.00
Frufru UTSW 7 68004163 missense probably damaging 1.00
Mimi UTSW 7 68195026 missense possibly damaging 0.67
Piroshka UTSW 7 68207336 nonsense probably null
Sublime UTSW 7 68004179 missense probably damaging 1.00
Toy UTSW 7 68003972 missense probably damaging 1.00
BB009:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
BB019:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
FR4548:Igf1r UTSW 7 68226186 small insertion probably benign
FR4737:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226181 small insertion probably benign
FR4976:Igf1r UTSW 7 68226186 small insertion probably benign
PIT4445001:Igf1r UTSW 7 68207463 missense probably damaging 1.00
R0003:Igf1r UTSW 7 68165242 missense probably damaging 1.00
R0184:Igf1r UTSW 7 68226193 missense possibly damaging 0.84
R0538:Igf1r UTSW 7 68207826 missense probably damaging 1.00
R0632:Igf1r UTSW 7 68165155 missense probably damaging 1.00
R0727:Igf1r UTSW 7 68212158 critical splice donor site probably null
R0750:Igf1r UTSW 7 68212091 missense probably damaging 0.99
R1104:Igf1r UTSW 7 68195026 missense possibly damaging 0.67
R1169:Igf1r UTSW 7 68165127 missense probably benign 0.00
R1348:Igf1r UTSW 7 68218468 missense probably damaging 1.00
R1471:Igf1r UTSW 7 68003837 missense probably damaging 0.98
R1580:Igf1r UTSW 7 68207869 missense probably benign
R1745:Igf1r UTSW 7 68169913 missense probably damaging 1.00
R1772:Igf1r UTSW 7 68195074 missense probably benign 0.03
R1789:Igf1r UTSW 7 68214933 nonsense probably null
R1823:Igf1r UTSW 7 68194981 missense possibly damaging 0.77
R1902:Igf1r UTSW 7 68201249 missense possibly damaging 0.93
R1962:Igf1r UTSW 7 68207275 missense probably damaging 0.99
R2179:Igf1r UTSW 7 68003950 missense probably damaging 0.99
R2215:Igf1r UTSW 7 68165234 missense probably benign
R2221:Igf1r UTSW 7 68201962 missense probably damaging 1.00
R2233:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2234:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R2235:Igf1r UTSW 7 68212080 missense probably damaging 1.00
R3023:Igf1r UTSW 7 68183399 missense probably benign 0.00
R4044:Igf1r UTSW 7 68190062 missense possibly damaging 0.83
R4226:Igf1r UTSW 7 68195078 nonsense probably null
R4387:Igf1r UTSW 7 68170009 missense probably benign
R4388:Igf1r UTSW 7 68170009 missense probably benign
R4728:Igf1r UTSW 7 68189624 missense probably damaging 1.00
R4781:Igf1r UTSW 7 68165199 missense possibly damaging 0.75
R5254:Igf1r UTSW 7 68207319 missense probably damaging 0.99
R5278:Igf1r UTSW 7 68193418 missense possibly damaging 0.78
R5510:Igf1r UTSW 7 68193359 missense probably benign 0.19
R5522:Igf1r UTSW 7 68183510 missense probably damaging 0.96
R5527:Igf1r UTSW 7 68207821 missense probably damaging 1.00
R5761:Igf1r UTSW 7 68207253 missense probably damaging 1.00
R5849:Igf1r UTSW 7 68190033 missense probably benign
R6189:Igf1r UTSW 7 68207336 nonsense probably null
R6262:Igf1r UTSW 7 68003972 missense probably damaging 1.00
R6285:Igf1r UTSW 7 68004137 missense possibly damaging 0.94
R6318:Igf1r UTSW 7 68165233 missense probably benign 0.02
R6365:Igf1r UTSW 7 68190050 missense probably benign 0.26
R6377:Igf1r UTSW 7 68201250 missense probably benign 0.00
R6831:Igf1r UTSW 7 68207319 missense possibly damaging 0.75
R6848:Igf1r UTSW 7 68004179 missense probably damaging 1.00
R6902:Igf1r UTSW 7 68004163 missense probably damaging 1.00
R7193:Igf1r UTSW 7 68187157 missense probably damaging 1.00
R7442:Igf1r UTSW 7 68173278 missense probably damaging 1.00
R7903:Igf1r UTSW 7 68184752 missense probably damaging 1.00
R7932:Igf1r UTSW 7 68212054 missense possibly damaging 0.88
RF025:Igf1r UTSW 7 68226179 small insertion probably benign
RF032:Igf1r UTSW 7 68226179 small insertion probably benign
RF034:Igf1r UTSW 7 68226176 small insertion probably benign
RF037:Igf1r UTSW 7 68226176 small insertion probably benign
RF039:Igf1r UTSW 7 68226176 small insertion probably benign
RF044:Igf1r UTSW 7 68226179 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CAGTTGTTCTCAAGTTAGCACACC -3'
(R):5'- GCTCCATGCACCCAAGTTAC -3'

Sequencing Primer
(F):5'- CAAGTTAGCACACCGTTTATCATTC -3'
(R):5'- CTACTCAATAAAGATGGCGTTGC -3'
Posted On2019-09-13