Mutagenetix > Incidental Mutations

Incidental Mutation 'R7373:Csmd1'

572218

Institutional Source

Beutler Lab

Gene Symbol

Csmd1

Ensembl Gene

ENSMUSG00000060924

Gene Name

CUB and Sushi multiple domains 1

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_053171.2

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7373 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

15892537-17535586 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15992713 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 2340 (N2340S)

Ref Sequence

ENSEMBL: ENSMUSP00000080751 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082104]

Predicted Effect

probably damaging
Transcript: ENSMUST00000082104
AA Change: N2340S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000080751
Gene: ENSMUSG00000060924
AA Change: N2340S

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
CUB	32	140	1.46e-26	SMART
CCP	145	202	1.01e-11	SMART
CUB	208	312	1.05e-27	SMART
CCP	349	406	1.28e-8	SMART
CUB	411	522	2.34e-25	SMART
CCP	527	580	1.22e-14	SMART
CUB	584	692	1.61e-37	SMART
CCP	697	754	4.41e-12	SMART
CUB	758	866	6.55e-38	SMART
CCP	873	926	2.53e-12	SMART
CUB	930	1040	8.94e-22	SMART
CCP	1045	1100	7.06e-11	SMART
CUB	1104	1212	3.14e-26	SMART
CCP	1217	1273	1.18e-12	SMART
CUB	1277	1386	9.72e-32	SMART
CCP	1391	1447	2.06e-12	SMART
CUB	1451	1559	1.68e-35	SMART
CCP	1564	1621	2.53e-12	SMART
CUB	1625	1733	4.24e-14	SMART
CCP	1741	1798	9.46e-12	SMART
CUB	1802	1910	4.23e-32	SMART
CCP	1915	1970	8.23e-12	SMART
CUB	1974	2082	8.59e-33	SMART
CCP	2087	2142	6.09e-15	SMART
CUB	2146	2253	2.36e-30	SMART
CCP	2258	2315	1.1e-12	SMART
CUB	2320	2430	4.3e-24	SMART
CCP	2432	2490	2.94e-8	SMART
CCP	2495	2552	2.03e-11	SMART
CCP	2557	2617	1.22e-5	SMART
CCP	2622	2675	2.72e-12	SMART
CCP	2680	2733	5.86e-17	SMART
CCP	2738	2791	6.09e-15	SMART
CCP	2796	2854	9.1e-14	SMART
CCP	2859	2912	3.96e-14	SMART
CCP	2920	2973	4.41e-12	SMART
CCP	2978	3032	2.94e-8	SMART
CCP	3037	3092	6.59e-11	SMART
CCP	3097	3150	4.12e-12	SMART
CCP	3155	3208	7.92e-14	SMART
CCP	3216	3270	2.8e-14	SMART
CCP	3275	3330	3.78e-11	SMART
transmembrane domain	3487	3509	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

98% (57/58)

MGI Phenotype

PHENOTYPE: Mice exhibit normal pre-pulse inhibition, social interaction, sucrose preference and d-amphetamine sensitivity. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts2	G	A	11: 50,795,435	A1027T	probably benign	Het
Aldh7a1	G	A	18: 56,542,317	T260M	possibly damaging	Het
Anks3	T	C	16: 4,955,871	Y187C	probably benign	Het
Atp2c2	A	T	8: 119,730,252	I198F	probably benign	Het
Bsn	T	C	9: 108,113,484	T1690A	probably damaging	Het
Catsper3	T	C	13: 55,808,132	I350T	possibly damaging	Het
Cdcp1	C	T	9: 123,177,900	R594H	probably damaging	Het
Cfap57	C	T	4: 118,614,931	V84I	probably benign	Het
Cldn1	G	T	16: 26,360,856	P154T	probably damaging	Het
Cntnap5a	A	T	1: 116,580,637	N1293I	probably benign	Het
Cpsf4l	C	T	11: 113,699,831		probably null	Het
Crybg1	T	C	10: 44,004,140	T351A	probably benign	Het
Dennd4a	C	A	9: 64,897,269	Q1297K	probably benign	Het
Dll3	A	G	7: 28,294,632	V460A	probably benign	Het
Dnah8	T	C	17: 30,767,965		probably null	Het
Dst	G	T	1: 34,188,391	L1688F	probably benign	Het
Ehmt1	A	G	2: 24,919,573	M1T	probably null	Het
Fasn	A	T	11: 120,813,976	L1261Q	possibly damaging	Het
Fat1	A	G	8: 45,026,665	D2916G	probably damaging	Het
Fgfr3	C	A	5: 33,727,690	F49L	probably benign	Het
Hlx	T	C	1: 184,730,865	T197A	probably benign	Het
Hormad1	A	T	3: 95,576,317	T147S	probably damaging	Het
Igf1r	T	A	7: 68,195,078	Y866*	probably null	Het
Itgb8	A	G	12: 119,202,475	V107A	probably benign	Het
Kat2a	C	T	11: 100,708,566	A533T	probably benign	Het
Kif20b	T	C	19: 34,935,671	L328P	probably damaging	Het
Lims1	T	C	10: 58,409,620	F157S	probably damaging	Het
Lrp2	G	T	2: 69,500,692	H1673Q	probably damaging	Het
Lrrc46	C	A	11: 97,038,880	M43I	probably benign	Het
Lrrk2	T	C	15: 91,700,004		probably null	Het
Meox2	A	T	12: 37,108,798		probably benign	Het
Mff	A	G	1: 82,737,117		probably null	Het
Mfsd5	T	A	15: 102,280,992	F266L	probably damaging	Het
Miga2	A	G	2: 30,382,071	T468A	probably damaging	Het
Mmel1	T	A	4: 154,889,208	L316Q	not run	Het
Ndufa9	C	A	6: 126,834,458	G232C	probably damaging	Het
Obox2	A	T	7: 15,397,220	K84*	probably null	Het
Olfr1311	T	A	2: 112,021,442	R137S	probably benign	Het
Olfr33	T	A	7: 102,714,099	I105F	possibly damaging	Het
Otogl	G	T	10: 107,901,251	Q101K	probably damaging	Het
Pcnx2	C	T	8: 125,808,027	V1288M	probably damaging	Het
Pde10a	T	A	17: 8,942,992	W220R	probably benign	Het
Recql5	T	C	11: 115,928,372	T123A	possibly damaging	Het
Rpl28	T	C	7: 4,793,603	V61A	probably benign	Het
Secisbp2l	A	T	2: 125,757,271	M494K	probably damaging	Het
Sh3bgr	G	A	16: 96,205,835	E2K	unknown	Het
Shcbp1l	C	A	1: 153,425,240	T6K	probably benign	Het
Slc22a15	A	C	3: 101,877,897	L353R	possibly damaging	Het
Sqle	T	C	15: 59,317,809	I100T	probably benign	Het
Tas2r106	A	T	6: 131,678,354	L178H	probably damaging	Het
Tll1	A	T	8: 64,051,357	N668K	probably damaging	Het
Tm7sf2	A	G	19: 6,066,646	S118P	probably benign	Het
Tmco5	G	T	2: 116,886,745	V169L	probably benign	Het
Trpv1	A	G	11: 73,240,673	K346E	probably damaging	Het
Ttk	G	A	9: 83,854,877	R463H	probably benign	Het
Vmn2r120	G	T	17: 57,509,406	L650I	probably benign	Het
Vmn2r58	C	T	7: 41,837,788	C561Y	probably damaging	Het
Vmn2r-ps117	A	T	17: 18,824,686	Q455L	probably benign	Het
Zfr	T	A	15: 12,140,559	S231T	unknown	Het

Other mutations in Csmd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Csmd1	APN	8	16009297	splice site	probably benign
IGL00433:Csmd1	APN	8	16231373	missense	probably damaging	1.00
IGL00500:Csmd1	APN	8	15921139	missense	probably damaging	1.00
IGL00666:Csmd1	APN	8	16189990	missense	probably damaging	1.00
IGL00913:Csmd1	APN	8	16071287	missense	probably benign	0.00
IGL01012:Csmd1	APN	8	15917341	missense	probably benign	0.00
IGL01123:Csmd1	APN	8	17534928	missense	possibly damaging	0.96
IGL01348:Csmd1	APN	8	15910596	missense	probably damaging	0.99
IGL01444:Csmd1	APN	8	16200055	missense	probably benign	0.00
IGL01530:Csmd1	APN	8	15903195	missense	probably damaging	0.99
IGL01548:Csmd1	APN	8	16288646	nonsense	probably null
IGL01814:Csmd1	APN	8	16501375	missense	probably damaging	1.00
IGL01889:Csmd1	APN	8	15998857	missense	probably damaging	1.00
IGL02055:Csmd1	APN	8	16069001	missense	probably damaging	0.99
IGL02066:Csmd1	APN	8	15926594	missense	probably damaging	1.00
IGL02097:Csmd1	APN	8	16211759	missense	probably null	0.17
IGL02112:Csmd1	APN	8	16081705	missense	probably benign	0.18
IGL02161:Csmd1	APN	8	16358412	missense	probably damaging	0.97
IGL02189:Csmd1	APN	8	16271606	missense	probably damaging	0.99
IGL02272:Csmd1	APN	8	16199893	missense	probably damaging	0.99
IGL02292:Csmd1	APN	8	16211870	missense	probably damaging	1.00
IGL02385:Csmd1	APN	8	15903275	missense	probably benign	0.08
IGL02424:Csmd1	APN	8	16092326	missense	probably benign	0.22
IGL02492:Csmd1	APN	8	16002597	missense	probably benign	0.13
IGL02507:Csmd1	APN	8	17534976	utr 5 prime	probably benign
IGL02513:Csmd1	APN	8	15999869	splice site	probably benign
IGL02727:Csmd1	APN	8	16231327	missense	probably damaging	1.00
IGL02728:Csmd1	APN	8	15999779	critical splice donor site	probably null
IGL02852:Csmd1	APN	8	15895728	missense	probably damaging	0.99
IGL02935:Csmd1	APN	8	16223334	missense	probably damaging	1.00
IGL02945:Csmd1	APN	8	16271570	missense	possibly damaging	0.92
IGL02959:Csmd1	APN	8	15910465	missense	probably damaging	0.99
IGL03113:Csmd1	APN	8	16028698	missense	probably benign
IGL03129:Csmd1	APN	8	15961521	missense	probably damaging	0.99
IGL03131:Csmd1	APN	8	16088217	missense	probably damaging	1.00
IGL03275:Csmd1	APN	8	16157092	missense	probably benign	0.00
IGL03297:Csmd1	APN	8	16009432	nonsense	probably null
ikura	UTSW	8	16231271	missense	probably damaging	1.00
I2289:Csmd1	UTSW	8	15912381	missense	probably benign	0.10
IGL03055:Csmd1	UTSW	8	16095501	missense	probably damaging	1.00
IGL03097:Csmd1	UTSW	8	15945127	missense	probably damaging	1.00
PIT4260001:Csmd1	UTSW	8	16070313	missense	probably damaging	1.00
PIT4378001:Csmd1	UTSW	8	15895728	missense	probably damaging	0.99
PIT4520001:Csmd1	UTSW	8	15906023	missense	probably benign	0.01
R0037:Csmd1	UTSW	8	15917248	missense	probably damaging	0.97
R0095:Csmd1	UTSW	8	16233051	missense	probably damaging	1.00
R0113:Csmd1	UTSW	8	15984849	missense	probably damaging	1.00
R0129:Csmd1	UTSW	8	16079942	missense	possibly damaging	0.95
R0144:Csmd1	UTSW	8	16391824	missense	probably benign	0.16
R0166:Csmd1	UTSW	8	16233022	missense	probably benign	0.29
R0227:Csmd1	UTSW	8	16391822	missense	probably benign	0.05
R0279:Csmd1	UTSW	8	16223235	missense	probably damaging	0.99
R0280:Csmd1	UTSW	8	16271602	missense	probably damaging	1.00
R0312:Csmd1	UTSW	8	15984760	missense	probably damaging	1.00
R0355:Csmd1	UTSW	8	15918330	missense	probably damaging	0.97
R0367:Csmd1	UTSW	8	15917270	missense	probably damaging	1.00
R0395:Csmd1	UTSW	8	16346638	missense	probably damaging	0.99
R0413:Csmd1	UTSW	8	16710514	missense	probably damaging	0.97
R0457:Csmd1	UTSW	8	16501393	critical splice acceptor site	probably null
R0463:Csmd1	UTSW	8	15921759	missense	probably damaging	0.99
R0482:Csmd1	UTSW	8	16233101	missense	probably damaging	1.00
R0501:Csmd1	UTSW	8	17027323	missense	probably damaging	0.97
R0505:Csmd1	UTSW	8	15992758	missense	probably damaging	1.00
R0507:Csmd1	UTSW	8	16185344	splice site	probably benign
R0511:Csmd1	UTSW	8	15932529	missense	possibly damaging	0.80
R0555:Csmd1	UTSW	8	16185273	missense	probably benign
R0580:Csmd1	UTSW	8	15910528	missense	probably damaging	1.00
R0610:Csmd1	UTSW	8	15918208	missense	possibly damaging	0.95
R0634:Csmd1	UTSW	8	16226391	missense	probably damaging	1.00
R0666:Csmd1	UTSW	8	16069049	missense	possibly damaging	0.88
R0674:Csmd1	UTSW	8	16000550	missense	probably benign	0.03
R0675:Csmd1	UTSW	8	16158131	missense	probably benign	0.01
R0763:Csmd1	UTSW	8	17027284	missense	possibly damaging	0.67
R0781:Csmd1	UTSW	8	15921174	missense	probably benign	0.35
R0862:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0864:Csmd1	UTSW	8	16190026	missense	probably damaging	0.99
R0925:Csmd1	UTSW	8	16710618	missense	probably benign	0.29
R0926:Csmd1	UTSW	8	16033576	splice site	probably null
R1005:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R1073:Csmd1	UTSW	8	16358463	splice site	probably benign
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1185:Csmd1	UTSW	8	16358348	missense	probably damaging	0.96
R1256:Csmd1	UTSW	8	16079964	missense	probably damaging	1.00
R1294:Csmd1	UTSW	8	16698036	missense	probably damaging	0.99
R1375:Csmd1	UTSW	8	16463081	splice site	probably null
R1447:Csmd1	UTSW	8	15925306	nonsense	probably null
R1450:Csmd1	UTSW	8	15945180	critical splice acceptor site	probably null
R1470:Csmd1	UTSW	8	16157204	splice site	probably benign
R1580:Csmd1	UTSW	8	15925299	missense	probably damaging	1.00
R1591:Csmd1	UTSW	8	15900710	missense	probably damaging	0.99
R1658:Csmd1	UTSW	8	16081725	missense	possibly damaging	0.69
R1678:Csmd1	UTSW	8	15918252	missense	possibly damaging	0.58
R1717:Csmd1	UTSW	8	17216692	missense	possibly damaging	0.58
R1735:Csmd1	UTSW	8	15932610	missense	probably damaging	0.99
R1750:Csmd1	UTSW	8	15917303	missense	probably damaging	0.99
R1753:Csmd1	UTSW	8	16157120	nonsense	probably null
R1822:Csmd1	UTSW	8	16223326	missense	probably damaging	1.00
R1875:Csmd1	UTSW	8	15929101	missense	probably damaging	0.99
R1909:Csmd1	UTSW	8	15906116	missense	probably damaging	1.00
R1912:Csmd1	UTSW	8	16233998	critical splice donor site	probably null
R1993:Csmd1	UTSW	8	16346684	missense	probably damaging	0.99
R2067:Csmd1	UTSW	8	15900782	missense	probably benign
R2094:Csmd1	UTSW	8	16079978	missense	probably damaging	0.99
R2119:Csmd1	UTSW	8	17216733	missense	probably damaging	0.98
R2127:Csmd1	UTSW	8	15917392	missense	probably damaging	1.00
R2138:Csmd1	UTSW	8	15929088	missense	probably damaging	0.96
R2216:Csmd1	UTSW	8	17027339	critical splice acceptor site	probably null
R2220:Csmd1	UTSW	8	15992641	missense	possibly damaging	0.94
R2380:Csmd1	UTSW	8	16190087	missense	probably damaging	1.00
R2471:Csmd1	UTSW	8	16211762	missense	probably damaging	1.00
R2984:Csmd1	UTSW	8	15953782	missense	probably damaging	1.00
R3001:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3002:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3003:Csmd1	UTSW	8	16196170	missense	probably damaging	0.98
R3103:Csmd1	UTSW	8	15917405	missense	probably damaging	1.00
R3104:Csmd1	UTSW	8	17027231	missense	probably damaging	1.00
R3620:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3621:Csmd1	UTSW	8	15992684	missense	probably benign	0.29
R3748:Csmd1	UTSW	8	15906071	missense	probably damaging	0.99
R3780:Csmd1	UTSW	8	16201986	missense	probably damaging	1.00
R3815:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3816:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3818:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3819:Csmd1	UTSW	8	16002522	missense	probably damaging	1.00
R3850:Csmd1	UTSW	8	16079922	missense	probably benign	0.00
R3945:Csmd1	UTSW	8	15910619	splice site	probably null
R3980:Csmd1	UTSW	8	15906056	nonsense	probably null
R4061:Csmd1	UTSW	8	15945158	missense	probably benign	0.00
R4086:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4087:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4089:Csmd1	UTSW	8	15992738	missense	probably damaging	0.99
R4183:Csmd1	UTSW	8	15910464	missense	probably damaging	0.99
R4226:Csmd1	UTSW	8	16000490	missense	probably damaging	0.99
R4454:Csmd1	UTSW	8	15945011	missense	probably damaging	0.99
R4533:Csmd1	UTSW	8	15931037	splice site	probably null
R4544:Csmd1	UTSW	8	16710636	missense	possibly damaging	0.93
R4547:Csmd1	UTSW	8	16391797	missense	possibly damaging	0.48
R4612:Csmd1	UTSW	8	15921908	splice site	probably null
R4620:Csmd1	UTSW	8	16002694	critical splice acceptor site	probably null
R4627:Csmd1	UTSW	8	16697917	missense	probably benign	0.00
R4633:Csmd1	UTSW	8	16002620	missense	probably damaging	0.99
R4646:Csmd1	UTSW	8	15932511	missense	possibly damaging	0.87
R4648:Csmd1	UTSW	8	15998788	nonsense	probably null
R4668:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.50
R4709:Csmd1	UTSW	8	16023891	missense	possibly damaging	0.96
R4709:Csmd1	UTSW	8	16710506	critical splice donor site	probably null
R4741:Csmd1	UTSW	8	15910447	missense	probably damaging	0.99
R4774:Csmd1	UTSW	8	16009369	missense	probably benign	0.11
R4793:Csmd1	UTSW	8	16088263	missense	probably damaging	1.00
R4829:Csmd1	UTSW	8	16127296	missense	probably damaging	1.00
R4888:Csmd1	UTSW	8	15895674	utr 3 prime	probably benign
R4896:Csmd1	UTSW	8	16009439	missense	probably benign	0.00
R4932:Csmd1	UTSW	8	16023765	missense	probably damaging	0.99
R4944:Csmd1	UTSW	8	15998772	missense	probably damaging	1.00
R4953:Csmd1	UTSW	8	16199917	missense	probably damaging	0.99
R4996:Csmd1	UTSW	8	15910452	missense	probably damaging	0.97
R5028:Csmd1	UTSW	8	15989090	missense	probably damaging	1.00
R5146:Csmd1	UTSW	8	16196190	missense	probably damaging	1.00
R5272:Csmd1	UTSW	8	16199944	missense	probably damaging	0.99
R5327:Csmd1	UTSW	8	17216712	missense	possibly damaging	0.94
R5399:Csmd1	UTSW	8	16710597	missense	probably damaging	1.00
R5411:Csmd1	UTSW	8	15910471	missense	probably damaging	1.00
R5462:Csmd1	UTSW	8	15961486	missense	probably benign	0.12
R5463:Csmd1	UTSW	8	15984860	missense	probably benign	0.34
R5497:Csmd1	UTSW	8	16085181	missense	probably benign	0.20
R5536:Csmd1	UTSW	8	16288660	missense	probably damaging	0.99
R5711:Csmd1	UTSW	8	15953703	missense	probably damaging	1.00
R5730:Csmd1	UTSW	8	16185192	nonsense	probably null
R5788:Csmd1	UTSW	8	16201966	missense	probably damaging	1.00
R5941:Csmd1	UTSW	8	15932471	missense	probably damaging	0.99
R5960:Csmd1	UTSW	8	16071416	missense	possibly damaging	0.68
R5961:Csmd1	UTSW	8	16070352	missense	probably damaging	0.99
R5969:Csmd1	UTSW	8	16071353	missense	probably benign	0.00
R5998:Csmd1	UTSW	8	15910443	missense	probably damaging	1.00
R6062:Csmd1	UTSW	8	16092305	missense	possibly damaging	0.68
R6109:Csmd1	UTSW	8	16199860	missense	possibly damaging	0.93
R6116:Csmd1	UTSW	8	16211850	missense	probably damaging	1.00
R6143:Csmd1	UTSW	8	16088301	missense	probably damaging	1.00
R6155:Csmd1	UTSW	8	15903231	missense	probably benign	0.01
R6197:Csmd1	UTSW	8	15926611	missense	probably benign	0.32
R6247:Csmd1	UTSW	8	16196235	missense	possibly damaging	0.91
R6304:Csmd1	UTSW	8	16058674	missense	probably damaging	1.00
R6317:Csmd1	UTSW	8	16710642	missense	possibly damaging	0.89
R6318:Csmd1	UTSW	8	15903212	missense	probably damaging	1.00
R6338:Csmd1	UTSW	8	15932492	missense	possibly damaging	0.75
R6369:Csmd1	UTSW	8	17535004	start gained	probably benign
R6447:Csmd1	UTSW	8	15910527	missense	probably damaging	1.00
R6454:Csmd1	UTSW	8	15921150	missense	probably damaging	0.99
R6494:Csmd1	UTSW	8	16211695	splice site	probably null
R6614:Csmd1	UTSW	8	17216787	missense	probably damaging	1.00
R6736:Csmd1	UTSW	8	16002626	missense	probably damaging	0.99
R6769:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6771:Csmd1	UTSW	8	16071394	missense	possibly damaging	0.80
R6804:Csmd1	UTSW	8	16037246	missense	probably damaging	1.00
R6818:Csmd1	UTSW	8	16185327	missense	probably damaging	1.00
R6863:Csmd1	UTSW	8	17534913	missense	possibly damaging	0.85
R6930:Csmd1	UTSW	8	16092395	missense	probably damaging	0.97
R6969:Csmd1	UTSW	8	17216789	missense	possibly damaging	0.94
R7112:Csmd1	UTSW	8	16101128	missense	probably damaging	1.00
R7124:Csmd1	UTSW	8	15903202	missense	probably damaging	1.00
R7167:Csmd1	UTSW	8	15926524	missense	probably benign
R7243:Csmd1	UTSW	8	15915357	missense	probably damaging	1.00
R7260:Csmd1	UTSW	8	16000574	missense	probably damaging	1.00
R7271:Csmd1	UTSW	8	17027279	missense	probably damaging	0.99
R7324:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7325:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7327:Csmd1	UTSW	8	16058707	missense	probably damaging	1.00
R7406:Csmd1	UTSW	8	16288693	missense	probably damaging	0.99
R7427:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7428:Csmd1	UTSW	8	16023850	missense	possibly damaging	0.91
R7445:Csmd1	UTSW	8	16158254	missense	possibly damaging	0.61
R7458:Csmd1	UTSW	8	15953738	missense	probably damaging	1.00
R7476:Csmd1	UTSW	8	15895731	missense	probably damaging	1.00
R7527:Csmd1	UTSW	8	16211718	missense	probably damaging	1.00
R7544:Csmd1	UTSW	8	16092296	missense	probably damaging	1.00
R7583:Csmd1	UTSW	8	15998833	missense	probably damaging	0.96
R7603:Csmd1	UTSW	8	16288682	missense	probably damaging	1.00
R7607:Csmd1	UTSW	8	15918331	missense	possibly damaging	0.94
R7642:Csmd1	UTSW	8	16085178	missense	probably damaging	0.99
R7669:Csmd1	UTSW	8	15917273	missense	probably damaging	1.00
R7720:Csmd1	UTSW	8	15931108	missense	probably damaging	1.00
R7728:Csmd1	UTSW	8	16231271	missense	probably damaging	1.00
R7738:Csmd1	UTSW	8	16100990	missense	probably damaging	1.00
R7745:Csmd1	UTSW	8	15932461	critical splice donor site	probably null
R7879:Csmd1	UTSW	8	16391806	missense	probably benign	0.28
R7884:Csmd1	UTSW	8	15961418	missense	probably damaging	1.00
R7897:Csmd1	UTSW	8	17534919	missense	possibly damaging	0.96
R8111:Csmd1	UTSW	8	15917306	missense	probably benign
R8119:Csmd1	UTSW	8	17027294	missense	probably damaging	0.99
R8134:Csmd1	UTSW	8	15932550	missense	probably damaging	0.99
R8187:Csmd1	UTSW	8	16127174	missense	probably damaging	0.99
R8196:Csmd1	UTSW	8	16009468	missense	probably benign	0.18
R8231:Csmd1	UTSW	8	16697923	missense	possibly damaging	0.82
R8242:Csmd1	UTSW	8	16710654	missense	probably benign	0.42
R8274:Csmd1	UTSW	8	15910453	missense	possibly damaging	0.93
R8286:Csmd1	UTSW	8	15989188	missense	probably benign	0.18
R8289:Csmd1	UTSW	8	16058702	missense	probably damaging	0.99
R8314:Csmd1	UTSW	8	16158244	missense	probably benign
R8323:Csmd1	UTSW	8	17216735	nonsense	probably null
R8387:Csmd1	UTSW	8	16000484	missense	possibly damaging	0.94
R8413:Csmd1	UTSW	8	15900676	missense	probably damaging	0.98
X0011:Csmd1	UTSW	8	16196263	missense	probably damaging	1.00
X0021:Csmd1	UTSW	8	16185256	missense	probably damaging	1.00
X0024:Csmd1	UTSW	8	16037218	missense	probably damaging	0.99
X0028:Csmd1	UTSW	8	15915333	missense	possibly damaging	0.79
Z1088:Csmd1	UTSW	8	15921875	missense	possibly damaging	0.91
Z1088:Csmd1	UTSW	8	16092258	missense	probably damaging	1.00
Z1088:Csmd1	UTSW	8	16189978	missense	possibly damaging	0.50
Z1088:Csmd1	UTSW	8	16200058	missense	probably damaging	0.97
Z1088:Csmd1	UTSW	8	16346617	missense	probably damaging	0.99
Z1176:Csmd1	UTSW	8	15998814	missense	probably damaging	1.00
Z1176:Csmd1	UTSW	8	16037198	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	15984708	missense	probably damaging	1.00
Z1177:Csmd1	UTSW	8	16200019	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTGCGACATTTACCACTTC -3'
(R):5'- TCCTGTATTAAACGTAGTCAGAGC -3'

Sequencing Primer
(F):5'- GGTGCGACATTTACCACTTCAATATC -3'
(R):5'- AGTCAGAGCTCAGTAGACTGTCTTC -3'

Posted On

2019-09-13