Incidental Mutation 'R7373:Cldn1'
ID572244
Institutional Source Beutler Lab
Gene Symbol Cldn1
Ensembl Gene ENSMUSG00000022512
Gene Nameclaudin 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7373 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location26356642-26371841 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 26360856 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 154 (P154T)
Ref Sequence ENSEMBL: ENSMUSP00000023154 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023154]
Predicted Effect probably damaging
Transcript: ENSMUST00000023154
AA Change: P154T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023154
Gene: ENSMUSG00000022512
AA Change: P154T

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 4 182 2e-54 PFAM
Pfam:Claudin_2 15 184 4.4e-10 PFAM
low complexity region 187 205 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The knockout mice lacking this gene die soon after birth as a consequence of dehydration from trandermal water loss, indicating that this gene is indispensable for creating and maintaining the epidermal barrier. The protein encoded by this gene also has gastric tumor suppressive activity, and is a key factor for hepatitis C virus (HCV) entry. [provided by RefSeq, Aug 2010]
PHENOTYPE: Animals homozygous for a mutation in this gene have wrinkled skin and die within 1 day after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,795,435 A1027T probably benign Het
Aldh7a1 G A 18: 56,542,317 T260M possibly damaging Het
Anks3 T C 16: 4,955,871 Y187C probably benign Het
Atp2c2 A T 8: 119,730,252 I198F probably benign Het
Bsn T C 9: 108,113,484 T1690A probably damaging Het
Catsper3 T C 13: 55,808,132 I350T possibly damaging Het
Cdcp1 C T 9: 123,177,900 R594H probably damaging Het
Cfap57 C T 4: 118,614,931 V84I not run Het
Cntnap5a A T 1: 116,580,637 N1293I probably benign Het
Cpsf4l C T 11: 113,699,831 probably null Het
Crybg1 T C 10: 44,004,140 T351A probably benign Het
Csmd1 T C 8: 15,992,713 N2340S probably damaging Het
Dennd4a C A 9: 64,897,269 Q1297K probably benign Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnah8 T C 17: 30,767,965 probably null Het
Dst G T 1: 34,188,391 L1688F probably benign Het
Ehmt1 A G 2: 24,919,573 M1T probably null Het
Fasn A T 11: 120,813,976 L1261Q possibly damaging Het
Fat1 A G 8: 45,026,665 D2916G probably damaging Het
Fgfr3 C A 5: 33,727,690 F49L probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hormad1 A T 3: 95,576,317 T147S probably damaging Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Itgb8 A G 12: 119,202,475 V107A probably benign Het
Kat2a C T 11: 100,708,566 A533T probably benign Het
Kif20b T C 19: 34,935,671 L328P probably damaging Het
Lims1 T C 10: 58,409,620 F157S probably damaging Het
Lrp2 G T 2: 69,500,692 H1673Q probably damaging Het
Lrrc46 C A 11: 97,038,880 M43I probably benign Het
Lrrk2 T C 15: 91,700,004 probably null Het
Meox2 A T 12: 37,108,798 probably benign Het
Mff A G 1: 82,737,117 probably null Het
Mfsd5 T A 15: 102,280,992 F266L probably damaging Het
Miga2 A G 2: 30,382,071 T468A probably damaging Het
Mmel1 T A 4: 154,889,208 L316Q not run Het
Ndufa9 C A 6: 126,834,458 G232C probably damaging Het
Obox2 A T 7: 15,397,220 K84* probably null Het
Olfr1311 T A 2: 112,021,442 R137S probably benign Het
Olfr33 T A 7: 102,714,099 I105F possibly damaging Het
Otogl G T 10: 107,901,251 Q101K probably damaging Het
Pcnx2 C T 8: 125,808,027 V1288M probably damaging Het
Pde10a T A 17: 8,942,992 W220R probably benign Het
Recql5 T C 11: 115,928,372 T123A possibly damaging Het
Rpl28 T C 7: 4,793,603 V61A probably benign Het
Secisbp2l A T 2: 125,757,271 M494K probably damaging Het
Sh3bgr G A 16: 96,205,835 E2K unknown Het
Shcbp1l C A 1: 153,425,240 T6K probably benign Het
Slc22a15 A C 3: 101,877,897 L353R possibly damaging Het
Sqle T C 15: 59,317,809 I100T probably benign Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tll1 A T 8: 64,051,357 N668K probably damaging Het
Tm7sf2 A G 19: 6,066,646 S118P probably benign Het
Tmco5 G T 2: 116,886,745 V169L probably benign Het
Trpv1 A G 11: 73,240,673 K346E probably damaging Het
Ttk G A 9: 83,854,877 R463H probably benign Het
Vmn2r120 G T 17: 57,509,406 L650I probably benign Het
Vmn2r58 C T 7: 41,837,788 C561Y probably damaging Het
Vmn2r-ps117 A T 17: 18,824,686 Q455L probably benign Het
Zfr T A 15: 12,140,559 S231T unknown Het
Other mutations in Cldn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Cldn1 APN 16 26371572 missense possibly damaging 0.59
IGL02937:Cldn1 APN 16 26360873 missense probably damaging 1.00
R1626:Cldn1 UTSW 16 26371452 missense probably damaging 1.00
R2131:Cldn1 UTSW 16 26371550 missense probably damaging 0.98
R2264:Cldn1 UTSW 16 26359199 missense probably damaging 1.00
R3778:Cldn1 UTSW 16 26371466 missense probably damaging 1.00
R4850:Cldn1 UTSW 16 26363163 missense probably benign 0.04
R5711:Cldn1 UTSW 16 26371417 missense probably damaging 1.00
R5753:Cldn1 UTSW 16 26363121 missense probably benign 0.01
R6017:Cldn1 UTSW 16 26363219 missense probably damaging 1.00
R7134:Cldn1 UTSW 16 26371626 start codon destroyed probably null 0.98
R7199:Cldn1 UTSW 16 26371596 missense probably benign 0.06
R7600:Cldn1 UTSW 16 26360919 missense probably benign
R7675:Cldn1 UTSW 16 26371511 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCATCAGTACCGGCTGTTAAAG -3'
(R):5'- TCAGCACTGTCGATGAGATTCAATTC -3'

Sequencing Primer
(F):5'- TCATTTTAACATGAGTCACAGGTC -3'
(R):5'- TGTAGGTCTGGCGACATT -3'
Posted On2019-09-13