Incidental Mutation 'R7373:Pde10a'
ID 572246
Institutional Source Beutler Lab
Gene Symbol Pde10a
Ensembl Gene ENSMUSG00000023868
Gene Name phosphodiesterase 10A
Synonyms
MMRRC Submission 045456-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7373 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 8744204-9205480 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 9161824 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Arginine at position 220 (W220R)
Ref Sequence ENSEMBL: ENSMUSP00000086485 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024647] [ENSMUST00000089085] [ENSMUST00000115708] [ENSMUST00000115715] [ENSMUST00000115717] [ENSMUST00000115720] [ENSMUST00000115724] [ENSMUST00000149440] [ENSMUST00000231430]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000024647
AA Change: W140R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000024647
Gene: ENSMUSG00000023868
AA Change: W140R

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000089085
AA Change: W220R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000086485
Gene: ENSMUSG00000023868
AA Change: W220R

DomainStartEndE-ValueType
GAF 101 254 1.44e-3 SMART
GAF 276 432 6.56e-29 SMART
HDc 522 688 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115708
SMART Domains Protein: ENSMUSP00000111373
Gene: ENSMUSG00000023868

DomainStartEndE-ValueType
GAF 3 148 5.22e-23 SMART
HDc 238 404 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115715
AA Change: W140R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000111380
Gene: ENSMUSG00000023868
AA Change: W140R

DomainStartEndE-ValueType
GAF 21 174 1.44e-3 SMART
GAF 196 352 6.56e-29 SMART
HDc 442 608 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115717
Predicted Effect probably benign
Transcript: ENSMUST00000115720
AA Change: W203R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000111385
Gene: ENSMUSG00000023868
AA Change: W203R

DomainStartEndE-ValueType
GAF 84 237 1.44e-3 SMART
GAF 259 415 6.56e-29 SMART
HDc 505 671 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115724
AA Change: W274R

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111389
Gene: ENSMUSG00000023868
AA Change: W274R

DomainStartEndE-ValueType
GAF 95 248 1.44e-3 SMART
GAF 270 426 6.56e-29 SMART
HDc 516 682 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149440
AA Change: W151R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000123216
Gene: ENSMUSG00000023868
AA Change: W151R

DomainStartEndE-ValueType
GAF 32 185 1.44e-3 SMART
GAF 207 363 6.56e-29 SMART
HDc 453 619 9.04e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000231430
AA Change: W502R

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous mutation of this gene results in decreased exploratory behavior, hypoactivity, and a delay in the acquisition of conditioned avoidance behavior. A hypomorphic allele results in increased social behavior. Mice homozygous for a knock-out allele exhibit resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,686,262 (GRCm39) A1027T probably benign Het
Aldh7a1 G A 18: 56,675,389 (GRCm39) T260M possibly damaging Het
Anks3 T C 16: 4,773,735 (GRCm39) Y187C probably benign Het
Atp2c2 A T 8: 120,456,991 (GRCm39) I198F probably benign Het
Bsn T C 9: 107,990,683 (GRCm39) T1690A probably damaging Het
Catsper3 T C 13: 55,955,945 (GRCm39) I350T possibly damaging Het
Cdcp1 C T 9: 123,006,965 (GRCm39) R594H probably damaging Het
Cfap57 C T 4: 118,472,128 (GRCm39) V84I probably benign Het
Cldn1 G T 16: 26,179,606 (GRCm39) P154T probably damaging Het
Cntnap5a A T 1: 116,508,367 (GRCm39) N1293I probably benign Het
Cpsf4l C T 11: 113,590,657 (GRCm39) probably null Het
Crybg1 T C 10: 43,880,136 (GRCm39) T351A probably benign Het
Csmd1 T C 8: 16,042,713 (GRCm39) N2340S probably damaging Het
Dennd4a C A 9: 64,804,551 (GRCm39) Q1297K probably benign Het
Dll3 A G 7: 27,994,057 (GRCm39) V460A probably benign Het
Dnah8 T C 17: 30,986,939 (GRCm39) probably null Het
Dst G T 1: 34,227,472 (GRCm39) L1688F probably benign Het
Ehmt1 A G 2: 24,809,585 (GRCm39) M1T probably null Het
Fasn A T 11: 120,704,802 (GRCm39) L1261Q possibly damaging Het
Fat1 A G 8: 45,479,702 (GRCm39) D2916G probably damaging Het
Fgfr3 C A 5: 33,885,034 (GRCm39) F49L probably benign Het
Hlx T C 1: 184,463,062 (GRCm39) T197A probably benign Het
Hormad1 A T 3: 95,483,628 (GRCm39) T147S probably damaging Het
Igf1r T A 7: 67,844,826 (GRCm39) Y866* probably null Het
Itgb8 A G 12: 119,166,210 (GRCm39) V107A probably benign Het
Kat2a C T 11: 100,599,392 (GRCm39) A533T probably benign Het
Kif20b T C 19: 34,913,071 (GRCm39) L328P probably damaging Het
Lims1 T C 10: 58,245,442 (GRCm39) F157S probably damaging Het
Lrp2 G T 2: 69,331,036 (GRCm39) H1673Q probably damaging Het
Lrrc46 C A 11: 96,929,706 (GRCm39) M43I probably benign Het
Lrrk2 T C 15: 91,584,207 (GRCm39) probably null Het
Meox2 A T 12: 37,158,797 (GRCm39) probably benign Het
Mff A G 1: 82,714,838 (GRCm39) probably null Het
Mfsd5 T A 15: 102,189,427 (GRCm39) F266L probably damaging Het
Miga2 A G 2: 30,272,083 (GRCm39) T468A probably damaging Het
Mmel1 T A 4: 154,973,665 (GRCm39) L316Q not run Het
Ndufa9 C A 6: 126,811,421 (GRCm39) G232C probably damaging Het
Obox2 A T 7: 15,131,145 (GRCm39) K84* probably null Het
Or4f58 T A 2: 111,851,787 (GRCm39) R137S probably benign Het
Or51a39 T A 7: 102,363,306 (GRCm39) I105F possibly damaging Het
Otogl G T 10: 107,737,112 (GRCm39) Q101K probably damaging Het
Pcnx2 C T 8: 126,534,766 (GRCm39) V1288M probably damaging Het
Recql5 T C 11: 115,819,198 (GRCm39) T123A possibly damaging Het
Rpl28 T C 7: 4,796,602 (GRCm39) V61A probably benign Het
Secisbp2l A T 2: 125,599,191 (GRCm39) M494K probably damaging Het
Sh3bgr G A 16: 96,007,035 (GRCm39) E2K unknown Het
Shcbp1l C A 1: 153,300,986 (GRCm39) T6K probably benign Het
Slc22a15 A C 3: 101,785,213 (GRCm39) L353R possibly damaging Het
Sqle T C 15: 59,189,658 (GRCm39) I100T probably benign Het
Tas2r106 A T 6: 131,655,317 (GRCm39) L178H probably damaging Het
Tll1 A T 8: 64,504,391 (GRCm39) N668K probably damaging Het
Tm7sf2 A G 19: 6,116,676 (GRCm39) S118P probably benign Het
Tmco5 G T 2: 116,717,226 (GRCm39) V169L probably benign Het
Trpv1 A G 11: 73,131,499 (GRCm39) K346E probably damaging Het
Ttk G A 9: 83,736,930 (GRCm39) R463H probably benign Het
Vmn2r120 G T 17: 57,816,406 (GRCm39) L650I probably benign Het
Vmn2r58 C T 7: 41,487,212 (GRCm39) C561Y probably damaging Het
Vmn2r-ps117 A T 17: 19,044,948 (GRCm39) Q455L probably benign Het
Zfr T A 15: 12,140,645 (GRCm39) S231T unknown Het
Other mutations in Pde10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Pde10a APN 17 9,163,802 (GRCm39) missense probably damaging 1.00
IGL01762:Pde10a APN 17 9,161,750 (GRCm39) missense possibly damaging 0.74
IGL01814:Pde10a APN 17 9,147,939 (GRCm39) start codon destroyed probably null 0.00
IGL02053:Pde10a APN 17 9,193,601 (GRCm39) missense probably damaging 1.00
IGL02386:Pde10a APN 17 9,172,636 (GRCm39) missense possibly damaging 0.93
IGL02573:Pde10a APN 17 9,180,722 (GRCm39) missense probably benign 0.38
IGL02583:Pde10a APN 17 9,200,462 (GRCm39) missense probably benign 0.23
IGL02649:Pde10a APN 17 9,172,604 (GRCm39) missense probably damaging 1.00
IGL02992:Pde10a APN 17 9,168,293 (GRCm39) missense probably damaging 0.97
IGL03109:Pde10a APN 17 9,148,046 (GRCm39) critical splice donor site probably null
brautigam UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
Bride UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
buzzed UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
Gracile UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
Nubile UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
thunderball UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R0004:Pde10a UTSW 17 9,200,408 (GRCm39) missense probably benign 0.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0015:Pde10a UTSW 17 9,196,029 (GRCm39) missense probably damaging 1.00
R0650:Pde10a UTSW 17 9,161,797 (GRCm39) missense probably damaging 1.00
R1173:Pde10a UTSW 17 9,139,378 (GRCm39) splice site probably benign
R1386:Pde10a UTSW 17 9,172,574 (GRCm39) missense probably damaging 1.00
R1458:Pde10a UTSW 17 9,183,540 (GRCm39) missense probably damaging 0.98
R1598:Pde10a UTSW 17 9,147,976 (GRCm39) missense probably damaging 1.00
R1661:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1665:Pde10a UTSW 17 9,117,702 (GRCm39) missense probably damaging 1.00
R1883:Pde10a UTSW 17 9,197,776 (GRCm39) missense possibly damaging 0.86
R1960:Pde10a UTSW 17 9,161,750 (GRCm39) missense possibly damaging 0.74
R2005:Pde10a UTSW 17 9,147,923 (GRCm39) critical splice acceptor site probably null
R2071:Pde10a UTSW 17 9,180,827 (GRCm39) missense probably benign 0.22
R2121:Pde10a UTSW 17 9,196,047 (GRCm39) missense probably damaging 1.00
R2376:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R3721:Pde10a UTSW 17 9,188,421 (GRCm39) missense probably damaging 1.00
R3872:Pde10a UTSW 17 8,975,923 (GRCm39) missense possibly damaging 0.92
R4627:Pde10a UTSW 17 9,200,484 (GRCm39) missense probably damaging 1.00
R4652:Pde10a UTSW 17 8,975,885 (GRCm39) missense possibly damaging 0.82
R5107:Pde10a UTSW 17 9,163,802 (GRCm39) missense probably damaging 1.00
R5184:Pde10a UTSW 17 9,195,987 (GRCm39) missense probably damaging 1.00
R5354:Pde10a UTSW 17 9,180,812 (GRCm39) missense probably damaging 0.97
R5735:Pde10a UTSW 17 9,160,024 (GRCm39) missense probably damaging 0.99
R5878:Pde10a UTSW 17 9,168,204 (GRCm39) missense possibly damaging 0.85
R5921:Pde10a UTSW 17 9,149,369 (GRCm39) missense probably damaging 1.00
R6027:Pde10a UTSW 17 9,183,509 (GRCm39) missense possibly damaging 0.78
R6145:Pde10a UTSW 17 9,147,949 (GRCm39) missense probably damaging 1.00
R6279:Pde10a UTSW 17 9,197,789 (GRCm39) missense probably damaging 0.99
R6409:Pde10a UTSW 17 9,168,270 (GRCm39) missense probably damaging 1.00
R6870:Pde10a UTSW 17 9,186,356 (GRCm39) missense possibly damaging 0.56
R6947:Pde10a UTSW 17 9,188,424 (GRCm39) missense probably damaging 1.00
R7072:Pde10a UTSW 17 9,161,858 (GRCm39) missense probably benign 0.40
R7084:Pde10a UTSW 17 9,159,994 (GRCm39) missense probably benign 0.25
R7294:Pde10a UTSW 17 8,975,853 (GRCm39) missense probably benign
R7339:Pde10a UTSW 17 8,975,860 (GRCm39) missense probably benign 0.01
R7347:Pde10a UTSW 17 9,186,294 (GRCm39) missense probably damaging 1.00
R7481:Pde10a UTSW 17 9,168,262 (GRCm39) missense possibly damaging 0.60
R7833:Pde10a UTSW 17 9,180,752 (GRCm39) missense possibly damaging 0.63
R7923:Pde10a UTSW 17 9,147,964 (GRCm39) missense probably benign 0.40
R8053:Pde10a UTSW 17 9,193,604 (GRCm39) missense probably benign 0.12
R8137:Pde10a UTSW 17 9,193,647 (GRCm39) missense possibly damaging 0.90
R8722:Pde10a UTSW 17 9,163,772 (GRCm39) missense probably benign 0.01
R8918:Pde10a UTSW 17 9,160,063 (GRCm39) missense possibly damaging 0.65
R8973:Pde10a UTSW 17 9,143,071 (GRCm39) missense probably benign
R9113:Pde10a UTSW 17 9,197,782 (GRCm39) missense probably benign
R9163:Pde10a UTSW 17 9,181,791 (GRCm39) missense possibly damaging 0.89
R9275:Pde10a UTSW 17 9,200,488 (GRCm39) makesense probably null
R9563:Pde10a UTSW 17 9,020,710 (GRCm39) missense unknown
R9641:Pde10a UTSW 17 9,197,816 (GRCm39) missense
R9660:Pde10a UTSW 17 9,170,370 (GRCm39) missense probably damaging 0.99
R9670:Pde10a UTSW 17 9,020,272 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGACACTGGCATCCACTGAG -3'
(R):5'- ACAGCTGCTCAAGAGAACAG -3'

Sequencing Primer
(F):5'- CTGGCATCCACTGAGTATGCATG -3'
(R):5'- GCTGCTCAAGAGAACAGGTTTTTAAG -3'
Posted On 2019-09-13