Incidental Mutation 'R7373:Vmn2r-ps117'
ID572247
Institutional Source Beutler Lab
Gene Symbol Vmn2r-ps117
Ensembl Gene ENSMUSG00000093531
Gene Namevomeronasal 2, receptor, pseudogene 117
SynonymsEG665303
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R7373 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location18810835-18838900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18824686 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 455 (Q455L)
Ref Sequence ENSEMBL: ENSMUSP00000156026 (fasta)
Predicted Effect probably benign
Transcript: ENSMUST00000176899
AA Change: Q455L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 98% (57/58)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts2 G A 11: 50,795,435 A1027T probably benign Het
Aldh7a1 G A 18: 56,542,317 T260M possibly damaging Het
Anks3 T C 16: 4,955,871 Y187C probably benign Het
Atp2c2 A T 8: 119,730,252 I198F probably benign Het
Bsn T C 9: 108,113,484 T1690A probably damaging Het
Catsper3 T C 13: 55,808,132 I350T possibly damaging Het
Cdcp1 C T 9: 123,177,900 R594H probably damaging Het
Cfap57 C T 4: 118,614,931 V84I probably benign Het
Cldn1 G T 16: 26,360,856 P154T probably damaging Het
Cntnap5a A T 1: 116,580,637 N1293I probably benign Het
Cpsf4l C T 11: 113,699,831 probably null Het
Crybg1 T C 10: 44,004,140 T351A probably benign Het
Csmd1 T C 8: 15,992,713 N2340S probably damaging Het
Dennd4a C A 9: 64,897,269 Q1297K probably benign Het
Dll3 A G 7: 28,294,632 V460A probably benign Het
Dnah8 T C 17: 30,767,965 probably null Het
Dst G T 1: 34,188,391 L1688F probably benign Het
Ehmt1 A G 2: 24,919,573 M1T probably null Het
Fasn A T 11: 120,813,976 L1261Q possibly damaging Het
Fat1 A G 8: 45,026,665 D2916G probably damaging Het
Fgfr3 C A 5: 33,727,690 F49L probably benign Het
Hlx T C 1: 184,730,865 T197A probably benign Het
Hormad1 A T 3: 95,576,317 T147S probably damaging Het
Igf1r T A 7: 68,195,078 Y866* probably null Het
Itgb8 A G 12: 119,202,475 V107A probably benign Het
Kat2a C T 11: 100,708,566 A533T probably benign Het
Kif20b T C 19: 34,935,671 L328P probably damaging Het
Lims1 T C 10: 58,409,620 F157S probably damaging Het
Lrp2 G T 2: 69,500,692 H1673Q probably damaging Het
Lrrc46 C A 11: 97,038,880 M43I probably benign Het
Lrrk2 T C 15: 91,700,004 probably null Het
Meox2 A T 12: 37,108,798 probably benign Het
Mff A G 1: 82,737,117 probably null Het
Mfsd5 T A 15: 102,280,992 F266L probably damaging Het
Miga2 A G 2: 30,382,071 T468A probably damaging Het
Mmel1 T A 4: 154,889,208 L316Q not run Het
Ndufa9 C A 6: 126,834,458 G232C probably damaging Het
Obox2 A T 7: 15,397,220 K84* probably null Het
Olfr1311 T A 2: 112,021,442 R137S probably benign Het
Olfr33 T A 7: 102,714,099 I105F possibly damaging Het
Otogl G T 10: 107,901,251 Q101K probably damaging Het
Pcnx2 C T 8: 125,808,027 V1288M probably damaging Het
Pde10a T A 17: 8,942,992 W220R probably benign Het
Recql5 T C 11: 115,928,372 T123A possibly damaging Het
Rpl28 T C 7: 4,793,603 V61A probably benign Het
Secisbp2l A T 2: 125,757,271 M494K probably damaging Het
Sh3bgr G A 16: 96,205,835 E2K unknown Het
Shcbp1l C A 1: 153,425,240 T6K probably benign Het
Slc22a15 A C 3: 101,877,897 L353R possibly damaging Het
Sqle T C 15: 59,317,809 I100T probably benign Het
Tas2r106 A T 6: 131,678,354 L178H probably damaging Het
Tll1 A T 8: 64,051,357 N668K probably damaging Het
Tm7sf2 A G 19: 6,066,646 S118P probably benign Het
Tmco5 G T 2: 116,886,745 V169L probably benign Het
Trpv1 A G 11: 73,240,673 K346E probably damaging Het
Ttk G A 9: 83,854,877 R463H probably benign Het
Vmn2r120 G T 17: 57,509,406 L650I probably benign Het
Vmn2r58 C T 7: 41,837,788 C561Y probably damaging Het
Zfr T A 15: 12,140,559 S231T unknown Het
Other mutations in Vmn2r-ps117
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6903:Vmn2r-ps117 UTSW 17 18838290 missense possibly damaging 0.94
R6912:Vmn2r-ps117 UTSW 17 18827202 missense probably damaging 1.00
R6934:Vmn2r-ps117 UTSW 17 18824705 nonsense probably null
R6953:Vmn2r-ps117 UTSW 17 18824833 missense probably benign
R6974:Vmn2r-ps117 UTSW 17 18838233 missense probably benign 0.15
R7630:Vmn2r-ps117 UTSW 17 18824647 missense probably benign 0.01
R7776:Vmn2r-ps117 UTSW 17 18823672 missense probably damaging 0.96
R8060:Vmn2r-ps117 UTSW 17 18837862 missense possibly damaging 0.85
R8126:Vmn2r-ps117 UTSW 17 18822552 missense probably benign 0.00
Z1177:Vmn2r-ps117 UTSW 17 18838076 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTGTACAGTCAGGTTTTCACTAAG -3'
(R):5'- TCCAAGTGTAATGGAACTTGAGTC -3'

Sequencing Primer
(F):5'- CAGTCAGGTTTTCACTAAGTCATC -3'
(R):5'- GCTGGCCATTGTATCATC -3'
Posted On2019-09-13