Incidental Mutation 'R7374:Olfr1061'
ID572253
Institutional Source Beutler Lab
Gene Symbol Olfr1061
Ensembl Gene ENSMUSG00000075185
Gene Nameolfactory receptor 1061
SynonymsMOR188-9, MOR188-1, MOR188-7, Olfr1515, GA_x6K02T2Q125-47883395-47882454, MOR188-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86413109-86414050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 86413852 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 67 (A67S)
Ref Sequence ENSEMBL: ENSMUSP00000097474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099889]
Predicted Effect probably benign
Transcript: ENSMUST00000099889
AA Change: A67S

PolyPhen 2 Score 0.392 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097474
Gene: ENSMUSG00000075185
AA Change: A67S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.5e-51 PFAM
Pfam:7tm_1 41 291 2.2e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Olfr1061
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01714:Olfr1061 APN 2 86413800 missense probably benign 0.35
IGL01721:Olfr1061 APN 2 86413333 missense probably damaging 1.00
IGL02696:Olfr1061 APN 2 86413615 missense probably benign 0.03
R0366:Olfr1061 UTSW 2 86414025 missense possibly damaging 0.71
R0607:Olfr1061 UTSW 2 86413170 missense probably damaging 1.00
R1013:Olfr1061 UTSW 2 86413975 missense possibly damaging 0.61
R1017:Olfr1061 UTSW 2 86413511 missense probably damaging 1.00
R1617:Olfr1061 UTSW 2 86413691 nonsense probably null
R1690:Olfr1061 UTSW 2 86413954 missense probably benign 0.03
R4126:Olfr1061 UTSW 2 86413224 missense probably damaging 0.99
R5053:Olfr1061 UTSW 2 86413338 missense probably damaging 1.00
R5443:Olfr1061 UTSW 2 86413593 missense possibly damaging 0.54
R6195:Olfr1061 UTSW 2 86413207 missense probably damaging 0.98
R6233:Olfr1061 UTSW 2 86413207 missense probably damaging 0.98
R6468:Olfr1061 UTSW 2 86414037 missense probably damaging 0.99
R7188:Olfr1061 UTSW 2 86413351 nonsense probably null
R7300:Olfr1061 UTSW 2 86413986 missense probably null 0.27
R7392:Olfr1061 UTSW 2 86413152 missense probably benign
R7494:Olfr1061 UTSW 2 86413248 missense probably benign 0.24
X0023:Olfr1061 UTSW 2 86413959 missense probably benign 0.29
Z1176:Olfr1061 UTSW 2 86413528 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TACAGATGGCCACATAACGG -3'
(R):5'- CAGGCTTTCTGATCTTCTCTAATGG -3'

Sequencing Primer
(F):5'- TGGCCACATAACGGTCATAAG -3'
(R):5'- TACAATAGTGACTGAATTCATCCTGG -3'
Posted On2019-09-13