Incidental Mutation 'R7374:Gria2'
ID572255
Institutional Source Beutler Lab
Gene Symbol Gria2
Ensembl Gene ENSMUSG00000033981
Gene Nameglutamate receptor, ionotropic, AMPA2 (alpha 2)
SynonymsGlur2, Glur-2, GluR-B, GluA2, GluR2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location80681450-80802835 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80741076 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 118 (T118A)
Ref Sequence ENSEMBL: ENSMUSP00000074787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075316] [ENSMUST00000107745] [ENSMUST00000192463]
Predicted Effect probably benign
Transcript: ENSMUST00000075316
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074787
Gene: ENSMUSG00000033981
AA Change: T118A

DomainStartEndE-ValueType
Pfam:ANF_receptor 49 379 2.7e-58 PFAM
PBPe 415 790 3.75e-132 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107745
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103374
Gene: ENSMUSG00000033981
AA Change: T118A

DomainStartEndE-ValueType
Pfam:ANF_receptor 47 379 4.8e-53 PFAM
PBPe 415 790 8.16e-133 SMART
Lig_chan-Glu_bd 425 490 2.96e-31 SMART
low complexity region 820 832 N/A INTRINSIC
low complexity region 853 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192463
AA Change: T118A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141447
Gene: ENSMUSG00000033981
AA Change: T118A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:ANF_receptor 47 379 1.7e-51 PFAM
PBPe 415 770 1.2e-105 SMART
Lig_chan-Glu_bd 425 490 2.2e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to a family of glutamate receptors that are sensitive to alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA), and function as ligand-activated cation channels. These channels are assembled from 4 related subunits, Gria1-4. The subunit encoded by this gene (Gria2) is subject to RNA editing (CAG->CGG; Q->R) within the second transmembrane domain, which is thought to render the channel impermeable to Ca(2+). Alternative splicing, resulting in transcript variants encoding different isoforms, (including the flip and flop isoforms that vary in their signal transduction properties), has been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit epilepsy, deficient dendritic architecture, altered exploratory behavior, impaired motor and learning performance, and increased mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Gria2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Gria2 APN 3 80710790 missense probably benign 0.12
IGL00832:Gria2 APN 3 80707251 missense probably damaging 1.00
IGL01086:Gria2 APN 3 80692381 missense probably damaging 1.00
IGL01409:Gria2 APN 3 80707697 critical splice donor site probably null
IGL01924:Gria2 APN 3 80710331 missense probably benign 0.13
IGL01999:Gria2 APN 3 80732091 missense probably damaging 1.00
IGL02355:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02362:Gria2 APN 3 80706937 missense probably damaging 1.00
IGL02389:Gria2 APN 3 80709422 missense probably benign 0.14
IGL02444:Gria2 APN 3 80702553 missense possibly damaging 0.65
IGL02532:Gria2 APN 3 80706999 missense probably damaging 1.00
IGL02991:Gria2 UTSW 3 80707809 nonsense probably null
R0015:Gria2 UTSW 3 80707767 missense probably damaging 1.00
R0148:Gria2 UTSW 3 80707731 missense probably damaging 1.00
R0201:Gria2 UTSW 3 80707838 missense probably damaging 1.00
R0411:Gria2 UTSW 3 80710858 splice site probably benign
R0551:Gria2 UTSW 3 80732026 splice site probably benign
R0655:Gria2 UTSW 3 80732070 nonsense probably null
R0866:Gria2 UTSW 3 80722024 splice site probably benign
R1393:Gria2 UTSW 3 80707098 missense probably damaging 1.00
R1458:Gria2 UTSW 3 80732045 missense possibly damaging 0.71
R1563:Gria2 UTSW 3 80691397 missense probably damaging 0.96
R1771:Gria2 UTSW 3 80692301 nonsense probably null
R1775:Gria2 UTSW 3 80691338 missense probably benign 0.09
R1902:Gria2 UTSW 3 80722108 missense probably damaging 0.98
R1993:Gria2 UTSW 3 80802357 missense probably benign
R1994:Gria2 UTSW 3 80802357 missense probably benign
R1995:Gria2 UTSW 3 80802357 missense probably benign
R2001:Gria2 UTSW 3 80710805 missense probably benign 0.28
R2389:Gria2 UTSW 3 80702625 missense probably damaging 1.00
R2520:Gria2 UTSW 3 80706962 missense probably damaging 1.00
R2679:Gria2 UTSW 3 80740953 splice site probably benign
R2865:Gria2 UTSW 3 80732085 missense probably benign 0.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2869:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2870:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2871:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R2872:Gria2 UTSW 3 80702492 missense probably damaging 1.00
R3716:Gria2 UTSW 3 80741004 missense possibly damaging 0.77
R3967:Gria2 UTSW 3 80710777 missense possibly damaging 0.95
R4285:Gria2 UTSW 3 80707662 intron probably benign
R4611:Gria2 UTSW 3 80692492 missense probably damaging 0.99
R4612:Gria2 UTSW 3 80732051 missense probably damaging 1.00
R4616:Gria2 UTSW 3 80706897 missense probably damaging 1.00
R4706:Gria2 UTSW 3 80740990 missense probably benign
R4996:Gria2 UTSW 3 80707141 missense probably damaging 0.99
R5502:Gria2 UTSW 3 80706945 missense probably damaging 1.00
R5930:Gria2 UTSW 3 80707249 missense possibly damaging 0.91
R6142:Gria2 UTSW 3 80801717 missense probably benign 0.13
R6233:Gria2 UTSW 3 80707203 missense probably damaging 0.99
R6317:Gria2 UTSW 3 80741004 missense possibly damaging 0.79
R6453:Gria2 UTSW 3 80740974 missense possibly damaging 0.93
R6526:Gria2 UTSW 3 80692469 missense probably damaging 1.00
R6545:Gria2 UTSW 3 80741144 missense probably damaging 0.99
R6574:Gria2 UTSW 3 80689296 missense probably damaging 0.99
R6720:Gria2 UTSW 3 80802304 missense probably benign 0.37
R7009:Gria2 UTSW 3 80706972 missense probably damaging 1.00
R7049:Gria2 UTSW 3 80689327 missense probably damaging 0.99
R7191:Gria2 UTSW 3 80732085 missense probably benign 0.24
R7225:Gria2 UTSW 3 80802631 unclassified probably benign
R7837:Gria2 UTSW 3 80710788 missense probably benign 0.18
R7920:Gria2 UTSW 3 80710788 missense probably benign 0.18
R8034:Gria2 UTSW 3 80801699 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATCACATAGCATCACATAGG -3'
(R):5'- CATGAAGGGATATTGCATTTCTGGC -3'

Sequencing Primer
(F):5'- GACCAAGGACAAATGCTGTGTTTG -3'
(R):5'- AGGGATATTGCATTTCTGGCCAATC -3'
Posted On2019-09-13