Incidental Mutation 'R7374:Rfx5'
ID572256
Institutional Source Beutler Lab
Gene Symbol Rfx5
Ensembl Gene ENSMUSG00000005774
Gene Nameregulatory factor X, 5 (influences HLA class II expression)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94954075-94961561 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94958742 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 451 (P451S)
Ref Sequence ENSEMBL: ENSMUSP00000029772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029772] [ENSMUST00000107253] [ENSMUST00000107254] [ENSMUST00000107255] [ENSMUST00000107260] [ENSMUST00000132393] [ENSMUST00000137088] [ENSMUST00000140331] [ENSMUST00000142311] [ENSMUST00000144132] [ENSMUST00000145031] [ENSMUST00000145472] [ENSMUST00000147237] [ENSMUST00000152869]
Predicted Effect unknown
Transcript: ENSMUST00000029772
AA Change: P451S
SMART Domains Protein: ENSMUSP00000029772
Gene: ENSMUSG00000005774
AA Change: P451S

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 7.2e-33 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107253
SMART Domains Protein: ENSMUSP00000102874
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 1.8e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107254
SMART Domains Protein: ENSMUSP00000102875
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 1.8e-33 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000107255
AA Change: P451S
SMART Domains Protein: ENSMUSP00000102876
Gene: ENSMUSG00000005774
AA Change: P451S

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 7.2e-33 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect unknown
Transcript: ENSMUST00000107260
AA Change: P451S
SMART Domains Protein: ENSMUSP00000102881
Gene: ENSMUSG00000005774
AA Change: P451S

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 88 167 5.3e-31 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132393
SMART Domains Protein: ENSMUSP00000117999
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
PDB:2KW3|B 23 89 9e-40 PDB
Predicted Effect unknown
Transcript: ENSMUST00000137088
AA Change: P451S
SMART Domains Protein: ENSMUSP00000117963
Gene: ENSMUSG00000005774
AA Change: P451S

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 7.2e-33 PFAM
RFX5_DNA_bdg 438 656 4.29e-130 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140331
Predicted Effect probably benign
Transcript: ENSMUST00000142311
SMART Domains Protein: ENSMUSP00000119704
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 131 4.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144132
Predicted Effect probably benign
Transcript: ENSMUST00000145031
SMART Domains Protein: ENSMUSP00000118099
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
PDB:2KW3|B 23 89 9e-40 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000145472
Predicted Effect probably benign
Transcript: ENSMUST00000147237
SMART Domains Protein: ENSMUSP00000118586
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 84 169 8.7e-34 PFAM
Pfam:Pox_D5 88 159 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152869
SMART Domains Protein: ENSMUSP00000121157
Gene: ENSMUSG00000005774

DomainStartEndE-ValueType
PDB:2KW3|B 23 89 7e-40 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice have absent or decreased expression of MHC-II complexes on antigen presenting cells, which leads to reduced numbers of CD4+ thymocytes and T cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Rfx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Rfx5 APN 3 94957775 unclassified probably benign
IGL01478:Rfx5 APN 3 94958440 missense possibly damaging 0.88
IGL02061:Rfx5 APN 3 94958481 missense probably benign 0.03
IGL02152:Rfx5 APN 3 94957182 missense probably damaging 1.00
IGL03395:Rfx5 APN 3 94957802 nonsense probably null
chip UTSW 3 94956355 missense probably damaging 1.00
R0098:Rfx5 UTSW 3 94958368 missense probably damaging 1.00
R0098:Rfx5 UTSW 3 94958368 missense probably damaging 1.00
R0505:Rfx5 UTSW 3 94956355 missense probably damaging 1.00
R0681:Rfx5 UTSW 3 94956355 missense probably damaging 1.00
R1342:Rfx5 UTSW 3 94958412 missense probably benign 0.09
R1460:Rfx5 UTSW 3 94956325 missense probably damaging 1.00
R1466:Rfx5 UTSW 3 94956303 missense probably damaging 1.00
R1466:Rfx5 UTSW 3 94956303 missense probably damaging 1.00
R1972:Rfx5 UTSW 3 94957292 missense probably damaging 1.00
R2173:Rfx5 UTSW 3 94956716 unclassified probably null
R4808:Rfx5 UTSW 3 94958280 missense probably benign 0.03
R4993:Rfx5 UTSW 3 94955815 missense probably benign 0.27
R4996:Rfx5 UTSW 3 94955815 missense probably benign 0.27
R5104:Rfx5 UTSW 3 94955140 missense probably benign 0.35
R5912:Rfx5 UTSW 3 94958718 unclassified probably benign
R7097:Rfx5 UTSW 3 94956539 missense probably damaging 1.00
R7186:Rfx5 UTSW 3 94958348 missense probably benign 0.01
R7194:Rfx5 UTSW 3 94955143 missense probably damaging 1.00
R7202:Rfx5 UTSW 3 94958961 missense unknown
R7203:Rfx5 UTSW 3 94958876 missense unknown
R7375:Rfx5 UTSW 3 94958742 missense unknown
RF061:Rfx5 UTSW 3 94955759 missense probably damaging 1.00
Z1176:Rfx5 UTSW 3 94955815 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCCTACTTTGTCAGGGGCTG -3'
(R):5'- AGGAGTAGCGTTTCTTTCCCC -3'

Sequencing Primer
(F):5'- GCCTTGGGCCTAGGTTTG -3'
(R):5'- CCTGGCTTCTTTCGAGGGC -3'
Posted On2019-09-13