Mutagenetix > Incidental Mutation

Incidental Mutation 'R0646:Dsc1'

57226

Institutional Source

Beutler Lab

Gene Symbol

Dsc1

Ensembl Gene

ENSMUSG00000044322

Gene Name

desmocollin 1

Synonyms

Dsc1a, Dsc1b

MMRRC Submission

038831-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R0646 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20084184-20114871 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 20096057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 392 (Y392C)

Ref Sequence

ENSEMBL: ENSMUSP00000153639 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038710] [ENSMUST00000224432]

AlphaFold

P55849

Predicted Effect

probably damaging
Transcript: ENSMUST00000038710
AA Change: Y392C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000042303
Gene: ENSMUSG00000044322
AA Change: Y392C

Domain	Start	End	E-Value	Type
low complexity region	16	26	N/A	INTRINSIC
Cadherin_pro	29	111	2.61e-41	SMART
CA	155	240	2.78e-9	SMART
CA	264	352	5.94e-27	SMART
CA	375	470	5.27e-10	SMART
CA	493	575	1.18e-21	SMART
Blast:CA	593	672	5e-46	BLAST
transmembrane domain	692	714	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000224432
AA Change: Y392C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224557

Meta Mutation Damage Score

0.8635

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (123/130)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of proteins that mediates adhesion in desmosomes. The encoded preproprotein undergoes proteolytic processing to generate the mature, functional protein. Mice lacking the encoded protein exhibit epidermal fragility together with defects of epidermal barrier and differentiation. The neonatal mice lacking the encoded protein exhibit epidermal lesions and older mice develop chronic dermatitis. This gene is located in a cluster of desmosomal cadherin genes on chromosome 18. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants with targeted disruptions of this gene have fragile epidermis, flaky skin, and defects in the epidermal barrier, leading to chronic dermatitis and display abnormal epidermal differentiation as indicated by hyperproliferation and overxpression of keratin 6 and 16. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	C	T	11: 23,575,491	R716H	probably damaging	Het
4930432E11Rik	C	T	7: 29,561,285		noncoding transcript	Het
A430078G23Rik	T	C	8: 3,386,959	Y250H	probably damaging	Het
Abcb11	A	G	2: 69,285,283	I579T	probably damaging	Het
Abcc9	T	C	6: 142,682,104	N400S	probably benign	Het
Adarb2	T	C	13: 8,731,819	L577P	probably damaging	Het
Agt	A	C	8: 124,557,113	N422K	probably damaging	Het
Ahnak	A	T	19: 9,013,402	K4017*	probably null	Het
Akap13	C	A	7: 75,747,746	Q2575K	probably damaging	Het
Aldh3a2	A	T	11: 61,253,715	I339K	probably damaging	Het
Alox15	G	T	11: 70,345,624	Y483*	probably null	Het
Ampd1	A	T	3: 103,099,597	I713F	probably damaging	Het
Amph	A	T	13: 19,113,116	E344V	possibly damaging	Het
Arid5b	A	G	10: 68,096,977	S1032P	probably damaging	Het
Armc8	C	A	9: 99,505,688	L393F	probably damaging	Het
Bpnt1	A	G	1: 185,345,426		probably null	Het
Cachd1	G	A	4: 100,988,221	R970H	probably damaging	Het
Cd207	T	C	6: 83,675,756	T131A	probably benign	Het
Cd83	G	A	13: 43,797,533	V54I	probably benign	Het
Cfap43	T	C	19: 47,763,676	K1086E	probably benign	Het
Cfap65	A	T	1: 74,902,169	V1837E	probably benign	Het
Clcnka	T	A	4: 141,396,606	H89L	probably benign	Het
Cnga4	T	C	7: 105,404,975	I50T	possibly damaging	Het
Cog5	A	G	12: 31,837,359		probably benign	Het
Col11a2	T	A	17: 34,059,348		probably null	Het
Col28a1	T	G	6: 8,175,291	I186L	possibly damaging	Het
Col4a2	T	A	8: 11,431,252	M808K	probably benign	Het
Copb2	A	G	9: 98,563,475		probably benign	Het
Dbnl	G	A	11: 5,795,441		probably benign	Het
Dbx2	T	C	15: 95,654,612	T51A	possibly damaging	Het
Dcp1a	A	T	14: 30,502,885	M123L	probably damaging	Het
Ddx42	T	A	11: 106,232,833	F217I	probably benign	Het
Dlc1	T	C	8: 36,858,051	T367A	probably benign	Het
Dmgdh	A	T	13: 93,752,355	T834S	probably benign	Het
Dnah8	T	C	17: 30,684,173	S929P	probably damaging	Het
Dnase1l2	C	A	17: 24,441,082	V271L	possibly damaging	Het
Edn1	T	C	13: 42,305,242		probably benign	Het
Eps8l3	T	C	3: 107,884,810	L351P	probably damaging	Het
F12	G	A	13: 55,422,483		probably benign	Het
Fam47e	T	C	5: 92,578,458		probably benign	Het
Fcrl5	C	A	3: 87,442,013	Q32K	probably benign	Het
Fndc1	C	T	17: 7,741,673	V1637I	possibly damaging	Het
Foxg1	G	T	12: 49,384,567		probably benign	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Galnt5	A	T	2: 57,999,085	K232N	probably benign	Het
Ggt5	G	A	10: 75,602,648	V68M	probably damaging	Het
Gm11639	G	A	11: 104,720,501	D390N	probably benign	Het
Gm13084	A	C	4: 143,812,585	S113A	possibly damaging	Het
Gm16519	T	C	17: 70,929,106	C17R	probably benign	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gm884	T	A	11: 103,613,160	K485*	probably null	Het
Gm9631	T	G	11: 121,945,629	D28A	probably damaging	Het
Gpx2	T	C	12: 76,795,313	I21M	probably benign	Het
H2-Q2	T	G	17: 35,345,685	D354E	probably damaging	Het
Icam2	A	T	11: 106,380,891	I71K	probably damaging	Het
Il12a	T	C	3: 68,697,890		probably benign	Het
Insm2	C	G	12: 55,600,440	A323G	probably benign	Het
Itga1	T	C	13: 114,968,299	T1064A	probably benign	Het
Itgad	T	A	7: 128,174,004	V11E	possibly damaging	Het
Kctd15	C	T	7: 34,644,881	S115N	probably damaging	Het
Klra5	A	G	6: 129,903,564	W124R	probably damaging	Het
Kng2	T	A	16: 22,987,736	D571V	probably benign	Het
Kpna6	A	T	4: 129,650,790	F380I	probably benign	Het
Lipo1	A	T	19: 33,784,769	Y109*	probably null	Het
Man2a2	T	C	7: 80,363,197	H540R	possibly damaging	Het
Map2k4	T	C	11: 65,712,275	E188G	probably damaging	Het
Mast4	T	C	13: 102,758,744		probably benign	Het
Mbtd1	A	G	11: 93,905,212	D25G	probably damaging	Het
Med13	T	A	11: 86,331,089	Q238L	possibly damaging	Het
Mmachc	A	G	4: 116,703,654	Y215H	probably damaging	Het
Mtor	T	A	4: 148,484,354	Y1110*	probably null	Het
Nek2	A	G	1: 191,822,219	N57D	probably damaging	Het
Nek7	ACCCC	ACCC	1: 138,515,693		probably null	Het
Neo1	G	T	9: 58,931,034	T489K	probably damaging	Het
Neu1	T	A	17: 34,934,760	Y387N	probably damaging	Het
Nfasc	A	T	1: 132,608,438	C586*	probably null	Het
Nle1	G	A	11: 82,904,845	L259F	probably damaging	Het
Nrde2	G	A	12: 100,143,846	Q309*	probably null	Het
Nufip2	C	T	11: 77,686,453	H76Y	probably benign	Het
Olfr1330	A	C	4: 118,893,490	T136P	probably damaging	Het
Olfr1383	A	T	11: 49,524,578	N285I	probably damaging	Het
Olfr466	A	T	13: 65,153,063	I280F	probably damaging	Het
Olfr584	T	C	7: 103,086,151	F206S	probably damaging	Het
Olfr670	A	T	7: 104,959,811	I307N	probably benign	Het
Olfr731	A	T	14: 50,238,639	I82N	probably damaging	Het
Pcdhb5	A	G	18: 37,321,622	T352A	probably benign	Het
Pcdhb7	A	T	18: 37,343,389	D526V	probably damaging	Het
Phkg1	A	T	5: 129,864,553		probably null	Het
Plg	C	T	17: 12,418,736	T744M	probably damaging	Het
Plxnd1	A	C	6: 115,958,699		probably benign	Het
Poglut1	A	T	16: 38,529,475	I312N	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppt1	A	G	4: 122,844,099	M77V	probably benign	Het
Pramel5	G	T	4: 144,271,620	T351N	probably damaging	Het
Psmb4	G	A	3: 94,884,964	R216C	probably benign	Het
Ptprd	T	C	4: 76,084,403	T699A	probably damaging	Het
Retreg3	A	T	11: 101,098,629		probably benign	Het
Scaper	G	A	9: 55,758,056	A389V	probably damaging	Het
Serinc5	G	A	13: 92,688,737	D225N	possibly damaging	Het
Slco1a1	T	G	6: 141,925,754		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sod3	A	T	5: 52,368,079	D40V	probably benign	Het
Sorcs3	C	A	19: 48,206,295	A39E	probably benign	Het
Spon1	A	T	7: 114,039,821	T761S	probably benign	Het
Syde2	A	G	3: 146,014,249		probably null	Het
Synm	T	A	7: 67,759,168	D154V	probably benign	Het
Synpo2	T	C	3: 123,114,449	E406G	probably damaging	Het
Tcea3	T	A	4: 136,248,071	L8*	probably null	Het
Tec	G	A	5: 72,823,497	L33F	probably damaging	Het
Tex15	T	A	8: 33,582,326	S2634T	possibly damaging	Het
Tg	T	A	15: 66,729,626	Y162N	probably damaging	Het
Tmem8b	G	A	4: 43,690,123	V853I	probably benign	Het
Togaram1	A	G	12: 65,021,466	K1748E	probably damaging	Het
Ttn	T	C	2: 76,898,478		probably benign	Het
Usp36	C	T	11: 118,273,021	D234N	probably damaging	Het
Usp40	G	A	1: 87,978,522	P664S	probably benign	Het
Vmn1r54	T	A	6: 90,269,653	L183H	probably benign	Het
Vmn1r58	T	G	7: 5,410,677	I185L	probably benign	Het
Wnt8a	A	T	18: 34,547,565	R328W	probably benign	Het
Yars	A	G	4: 129,213,939		probably benign	Het
Zbtb49	A	C	5: 38,200,674	M745R	probably damaging	Het
Zeb1	T	G	18: 5,759,027	F162V	probably damaging	Het
Zfp369	A	T	13: 65,297,548	H835L	probably damaging	Het
Zic5	A	G	14: 122,463,939	V460A	unknown	Het
Zp3	A	G	5: 135,984,356	N181D	possibly damaging	Het

Other mutations in Dsc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Dsc1	APN	18	20101886	missense	probably damaging	1.00
IGL00571:Dsc1	APN	18	20110138	missense	probably damaging	1.00
IGL00790:Dsc1	APN	18	20094896	missense	probably damaging	1.00
IGL00963:Dsc1	APN	18	20111986	missense	probably null	0.01
IGL00972:Dsc1	APN	18	20088363	missense	probably benign	0.32
IGL01112:Dsc1	APN	18	20094622	missense	probably benign	0.02
IGL01458:Dsc1	APN	18	20099138	missense	probably damaging	1.00
IGL01607:Dsc1	APN	18	20089663	missense	probably damaging	1.00
IGL01794:Dsc1	APN	18	20110183	missense	probably damaging	1.00
IGL01959:Dsc1	APN	18	20097225	missense	probably damaging	1.00
IGL02066:Dsc1	APN	18	20108803	unclassified	probably benign
IGL02365:Dsc1	APN	18	20108816	missense	probably damaging	1.00
IGL02714:Dsc1	APN	18	20087485	missense	probably damaging	1.00
IGL02959:Dsc1	APN	18	20108885	missense	probably damaging	1.00
IGL03019:Dsc1	APN	18	20088364	missense	probably benign	0.00
IGL03106:Dsc1	APN	18	20086644	splice site	probably null
R0414:Dsc1	UTSW	18	20088354	missense	possibly damaging	0.85
R0456:Dsc1	UTSW	18	20099112	missense	probably damaging	1.00
R0612:Dsc1	UTSW	18	20114516	missense	probably damaging	0.96
R0630:Dsc1	UTSW	18	20085862	missense	probably damaging	1.00
R0928:Dsc1	UTSW	18	20110249	splice site	probably null
R0976:Dsc1	UTSW	18	20095041	splice site	probably null
R1221:Dsc1	UTSW	18	20114542	nonsense	probably null
R1398:Dsc1	UTSW	18	20088336	missense	probably damaging	1.00
R1902:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R1903:Dsc1	UTSW	18	20095988	missense	probably damaging	1.00
R2070:Dsc1	UTSW	18	20088296	splice site	probably null
R2119:Dsc1	UTSW	18	20110152	missense	probably benign	0.07
R3935:Dsc1	UTSW	18	20097241	missense	probably benign	0.00
R4747:Dsc1	UTSW	18	20094558	missense	probably damaging	1.00
R5034:Dsc1	UTSW	18	20095027	missense	possibly damaging	0.91
R5243:Dsc1	UTSW	18	20099159	missense	probably damaging	1.00
R5289:Dsc1	UTSW	18	20101853	missense	possibly damaging	0.72
R5300:Dsc1	UTSW	18	20094860	missense	probably damaging	1.00
R5354:Dsc1	UTSW	18	20087575	missense	probably damaging	1.00
R5376:Dsc1	UTSW	18	20088446	missense	probably benign	0.21
R5808:Dsc1	UTSW	18	20086829	nonsense	probably null
R5860:Dsc1	UTSW	18	20095024	missense	probably damaging	1.00
R6059:Dsc1	UTSW	18	20110242	missense	probably damaging	0.98
R6116:Dsc1	UTSW	18	20097299	missense	probably benign	0.10
R6351:Dsc1	UTSW	18	20086769	missense	probably damaging	1.00
R6422:Dsc1	UTSW	18	20095033	missense	probably damaging	1.00
R6811:Dsc1	UTSW	18	20089654	missense	probably benign
R6880:Dsc1	UTSW	18	20088372	missense	probably damaging	0.99
R6941:Dsc1	UTSW	18	20097189	missense	probably benign	0.00
R6997:Dsc1	UTSW	18	20086644	splice site	probably null
R7255:Dsc1	UTSW	18	20097273	missense	probably benign	0.12
R7456:Dsc1	UTSW	18	20086822	missense	probably benign	0.00
R7492:Dsc1	UTSW	18	20107680	missense	possibly damaging	0.46
R7503:Dsc1	UTSW	18	20085865	missense	probably damaging	1.00
R8030:Dsc1	UTSW	18	20089571	missense	probably benign
R8167:Dsc1	UTSW	18	20097201	missense	probably damaging	1.00
R8444:Dsc1	UTSW	18	20089579	missense	probably benign	0.00
R8701:Dsc1	UTSW	18	20107682	nonsense	probably null
R8928:Dsc1	UTSW	18	20110168	missense	probably benign	0.01
R9133:Dsc1	UTSW	18	20101847	missense	probably benign	0.00
R9144:Dsc1	UTSW	18	20085582	missense	possibly damaging	0.95
R9189:Dsc1	UTSW	18	20099157	missense	possibly damaging	0.52
R9330:Dsc1	UTSW	18	20110157	missense	possibly damaging	0.67
R9372:Dsc1	UTSW	18	20088432	missense	probably damaging	1.00
R9565:Dsc1	UTSW	18	20107734	missense	probably damaging	0.99
R9685:Dsc1	UTSW	18	20099030	missense	possibly damaging	0.88
R9702:Dsc1	UTSW	18	20094628	missense	probably benign	0.06
Z1176:Dsc1	UTSW	18	20114538	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- AACTGCCTCTAACTCCCCGGAGAT -3'
(R):5'- ACCTCACAGAACGTAAGATATGGGTCA -3'

Sequencing Primer
(F):5'- CGGAGATGGGTTCATAGACAG -3'
(R):5'- ACGTAAGATATGGGTCACCTTAG -3'

Posted On

2013-07-11