Incidental Mutation 'R7374:Vmn2r68'
ID572272
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 85232399 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 491 (M491K)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061074
AA Change: M491K

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: M491K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CAATGAAAGACCTGGTTTAACACAC -3'
(R):5'- GGAAGCCTAGTTGAATCCAAAATGAC -3'

Sequencing Primer
(F):5'- CTTTATACCCAGAACTCGGGAGG -3'
(R):5'- CCTAGTTGAATCCAAAATGACAAATG -3'
Posted On2019-09-13