Incidental Mutation 'R7374:Gas6'
ID572277
Institutional Source Beutler Lab
Gene Symbol Gas6
Ensembl Gene ENSMUSG00000031451
Gene Namegrowth arrest specific 6
Synonymsgrowth arrest-specific, Gas-6, GAS 6
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13465374-13494490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13474802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 330 (V330D)
Ref Sequence ENSEMBL: ENSMUSP00000033828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033828]
Predicted Effect probably damaging
Transcript: ENSMUST00000033828
AA Change: V330D

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000033828
Gene: ENSMUSG00000031451
AA Change: V330D

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
GLA 26 90 6.66e-30 SMART
EGF 116 151 3.97e0 SMART
EGF_CA 153 193 3.1e-11 SMART
EGF_CA 194 234 1.91e-11 SMART
EGF_CA 235 275 1.25e-6 SMART
LamG 314 450 2.71e-24 SMART
LamG 502 647 1.27e-15 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a gamma-carboxyglutamic acid (Gla)-containing protein thought to be involved in the stimulation of cell proliferation. This gene is frequently overexpressed in many cancers and has been implicated as an adverse prognostic marker. Elevated protein levels are additionally associated with a variety of disease states, including venous thromboembolic disease, systemic lupus erythematosus, chronic renal failure, and preeclampsia. [provided by RefSeq, Aug 2014]
PHENOTYPE: Homozygous null mice are protected against arterial and venous thrombosis, and though platelet aggregation is impaired, spontaneous or excess trauma-induced bleeding is not observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Gas6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Gas6 APN 8 13476171 missense probably damaging 0.99
IGL01100:Gas6 APN 8 13475118 missense probably benign 0.27
IGL02014:Gas6 APN 8 13468359 missense possibly damaging 0.59
IGL02931:Gas6 APN 8 13477136 missense probably damaging 0.98
R0023:Gas6 UTSW 8 13470344 missense probably damaging 1.00
R0497:Gas6 UTSW 8 13470387 missense possibly damaging 0.86
R1126:Gas6 UTSW 8 13483700 missense probably benign 0.02
R1597:Gas6 UTSW 8 13493901 missense probably damaging 1.00
R1601:Gas6 UTSW 8 13465786 missense probably damaging 1.00
R1643:Gas6 UTSW 8 13465902 critical splice acceptor site probably null
R1914:Gas6 UTSW 8 13477152 missense probably benign
R1967:Gas6 UTSW 8 13470317 missense probably damaging 0.98
R2012:Gas6 UTSW 8 13468266 missense probably damaging 1.00
R4663:Gas6 UTSW 8 13470254 missense probably damaging 1.00
R4723:Gas6 UTSW 8 13466848 missense probably damaging 0.99
R4750:Gas6 UTSW 8 13476227 missense probably benign 0.29
R4869:Gas6 UTSW 8 13475086 missense possibly damaging 0.55
R5558:Gas6 UTSW 8 13466764 missense probably null 0.03
R5706:Gas6 UTSW 8 13477098 missense probably damaging 0.98
R5791:Gas6 UTSW 8 13470217 critical splice donor site probably null
R6767:Gas6 UTSW 8 13465784 missense probably damaging 0.98
R6825:Gas6 UTSW 8 13483674 missense probably benign 0.00
R7419:Gas6 UTSW 8 13471456 missense probably benign 0.19
R7588:Gas6 UTSW 8 13466711 missense probably benign 0.03
R7810:Gas6 UTSW 8 13466809 missense probably damaging 1.00
X0063:Gas6 UTSW 8 13471538 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGACTAACTAGAGCAGGAGC -3'
(R):5'- AGCTCCACCTCTGAGAGAAC -3'

Sequencing Primer
(F):5'- CCCAAATGCTAGGGATAGCCTTG -3'
(R):5'- GAGAGAACCAGCTCCCCATGTG -3'
Posted On2019-09-13