Mutagenetix > Incidental Mutation

Incidental Mutation 'R7374:Ntn4'

572281

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7374 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93682572 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 247 (H247R)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

probably benign
Transcript: ENSMUST00000020204
AA Change: H247R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: H247R

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	A	15: 8,247,247	W2792R	unknown	Het
Abca13	C	T	11: 9,292,136	T1333I	possibly damaging	Het
Abcd4	A	T	12: 84,606,243	L395*	probably null	Het
Cdh23	G	A	10: 60,317,900	R2304W	probably damaging	Het
Ckap2l	T	C	2: 129,284,963	T432A	probably damaging	Het
Cyp2c68	T	C	19: 39,739,204		probably null	Het
Ddx51	C	A	5: 110,657,132	T580K	probably damaging	Het
Fbxo44	T	A	4: 148,156,637	D112V	probably benign	Het
Ffar2	T	C	7: 30,820,040	N25S	probably damaging	Het
Gas6	A	T	8: 13,474,802	V330D	probably damaging	Het
Gfpt1	A	G	6: 87,050,977	T22A	probably benign	Het
Gm3371	A	G	14: 44,403,783	V108A		Het
Gm8257	T	C	14: 44,650,283	E215G	probably benign	Het
Gria1	T	A	11: 57,189,808	S206T	probably benign	Het
Gria2	T	C	3: 80,741,076	T118A	probably benign	Het
Hfe	T	G	13: 23,706,047	T248P	probably damaging	Het
Kdm5d	T	C	Y: 941,491	W1231R	probably benign	Het
Ltbp2	C	T	12: 84,830,175	D419N	probably damaging	Het
Mei1	G	A	15: 82,095,908	A232T		Het
Mgam	G	A	6: 40,757,439	E1473K	possibly damaging	Het
Mtbp	A	C	15: 55,562,959	E99A	possibly damaging	Het
Muc5b	A	T	7: 141,863,126	T3270S	probably benign	Het
Myl2	A	G	5: 122,101,663	Y28C		Het
Nrxn1	A	G	17: 90,588,669		probably null	Het
Numa1	T	C	7: 102,009,128	V1568A	probably benign	Het
Nyap1	C	T	5: 137,735,529	G414D	probably damaging	Het
Olfr1061	C	A	2: 86,413,852	A67S	probably benign	Het
Olfr493	A	G	7: 108,346,888	F31S	probably damaging	Het
Pdgfrb	G	A	18: 61,071,708	V547I	possibly damaging	Het
Pom121l12	A	T	11: 14,599,962	M223L	probably benign	Het
Prps1l1	T	C	12: 34,985,425	S180P	possibly damaging	Het
Ptprf	A	G	4: 118,257,492	S189P	probably damaging	Het
Radil	G	A	5: 142,485,480	R1014W	probably damaging	Het
Rfx5	C	T	3: 94,958,742	P451S	unknown	Het
Rhbdl2	G	C	4: 123,817,865	V132L	probably benign	Het
Slc15a2	G	T	16: 36,751,845	T719K	probably benign	Het
Slc9a9	A	G	9: 95,055,489	T465A	possibly damaging	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Sv2a	A	T	3: 96,188,209	Y306F	probably benign	Het
Sv2c	A	T	13: 95,989,136	H364Q	probably damaging	Het
Tmem181a	T	A	17: 6,304,258	L401Q	possibly damaging	Het
Trav9d-4	A	G	14: 52,983,843	Y98C	probably damaging	Het
Trim33	T	A	3: 103,310,323	C195S	probably damaging	Het
Uroc1	T	C	6: 90,338,833	Y191H	probably damaging	Het
Usp9y	T	C	Y: 1,381,305	I839V	probably benign	Het
Vmn1r52	A	T	6: 90,179,136	I141F	probably benign	Het
Vmn1r59	T	C	7: 5,454,161	H200R	probably damaging	Het
Vmn2r68	A	T	7: 85,232,399	M491K	possibly damaging	Het
Vmn2r74	T	C	7: 85,957,422	I239V	probably benign	Het
Wrn	A	C	8: 33,268,911	C1006W	probably damaging	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CACTGTGCAAACAATCCAGGG -3'
(R):5'- GACTATAGTCCCCAAAACTGAAGG -3'

Sequencing Primer
(F):5'- AACAATCCAGGGCGTGC -3'
(R):5'- CCAAAACTGAAGGTAATTTCCGG -3'

Posted On

2019-09-13