Incidental Mutation 'R7374:Abcd4'
ID572286
Institutional Source Beutler Lab
Gene Symbol Abcd4
Ensembl Gene ENSMUSG00000021240
Gene NameATP-binding cassette, sub-family D (ALD), member 4
SynonymsPxmp1l, P69r
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location84601464-84617413 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 84606243 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 395 (L395*)
Ref Sequence ENSEMBL: ENSMUSP00000021666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021666] [ENSMUST00000222581] [ENSMUST00000223107]
Predicted Effect probably null
Transcript: ENSMUST00000021666
AA Change: L395*
SMART Domains Protein: ENSMUSP00000021666
Gene: ENSMUSG00000021240
AA Change: L395*

DomainStartEndE-ValueType
Pfam:ABC_membrane_2 14 294 5.4e-86 PFAM
AAA 413 604 2.05e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222581
Predicted Effect probably null
Transcript: ENSMUST00000223107
AA Change: L391*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ALD subfamily, which is involved in peroxisomal import of fatty acids and/or fatty acyl-CoAs in the organelle. All known peroxisomal ABC transporters are half transporters which require a partner half transporter molecule to form a functional homodimeric or heterodimeric transporter. The function of this peroxisomal membrane protein is unknown. However, it is speculated that the human protein may function as a heterodimer for another peroxisomal ABC transporter and, therefore, may modify the adrenoleukodystrophy phenotype. It may also play a role in the process of peroxisome biogenesis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Cyp2c68 T C 19: 39,739,204 probably null Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Abcd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Abcd4 APN 12 84608804 critical splice donor site probably null
IGL02103:Abcd4 APN 12 84612364 missense probably benign 0.00
IGL02892:Abcd4 APN 12 84604997 nonsense probably null
R0112:Abcd4 UTSW 12 84612899 splice site probably benign
R0128:Abcd4 UTSW 12 84612352 missense possibly damaging 0.89
R0144:Abcd4 UTSW 12 84605965 critical splice acceptor site probably null
R0866:Abcd4 UTSW 12 84611733 missense probably damaging 1.00
R0942:Abcd4 UTSW 12 84612828 missense probably damaging 0.96
R1770:Abcd4 UTSW 12 84615100 missense probably benign 0.08
R1796:Abcd4 UTSW 12 84615382 missense probably benign 0.09
R2113:Abcd4 UTSW 12 84609016 nonsense probably null
R3713:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R3714:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R3715:Abcd4 UTSW 12 84611759 missense probably benign 0.43
R5308:Abcd4 UTSW 12 84603293 critical splice donor site probably null
R5572:Abcd4 UTSW 12 84606276 missense probably benign 0.04
R5632:Abcd4 UTSW 12 84617302 missense probably benign 0.00
R5695:Abcd4 UTSW 12 84613971 missense probably damaging 1.00
R6111:Abcd4 UTSW 12 84615114 missense probably damaging 1.00
R6538:Abcd4 UTSW 12 84611761 missense probably benign 0.12
R7035:Abcd4 UTSW 12 84615349 missense probably damaging 1.00
R7139:Abcd4 UTSW 12 84606298 missense probably benign
R7368:Abcd4 UTSW 12 84612865 missense possibly damaging 0.56
R7601:Abcd4 UTSW 12 84613945 missense possibly damaging 0.93
R7663:Abcd4 UTSW 12 84606129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAGCCAGCATCTGCACTG -3'
(R):5'- TGAAGGGCATAGTTACACCCC -3'

Sequencing Primer
(F):5'- AGCATCTGCACTGAGCCTG -3'
(R):5'- GGGCATAGTTACACCCCTAAGG -3'
Posted On2019-09-13