Incidental Mutation 'R7374:Cyp2c68'
ID572301
Institutional Source Beutler Lab
Gene Symbol Cyp2c68
Ensembl Gene ENSMUSG00000074882
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 68
Synonyms9030012A22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7374 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location39688834-39741054 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 39739204 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000097071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099472]
Predicted Effect probably null
Transcript: ENSMUST00000099472
SMART Domains Protein: ENSMUSP00000097071
Gene: ENSMUSG00000074882

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 2.1e-150 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,247,247 W2792R unknown Het
Abca13 C T 11: 9,292,136 T1333I possibly damaging Het
Abcd4 A T 12: 84,606,243 L395* probably null Het
Cdh23 G A 10: 60,317,900 R2304W probably damaging Het
Ckap2l T C 2: 129,284,963 T432A probably damaging Het
Ddx51 C A 5: 110,657,132 T580K probably damaging Het
Fbxo44 T A 4: 148,156,637 D112V probably benign Het
Ffar2 T C 7: 30,820,040 N25S probably damaging Het
Gas6 A T 8: 13,474,802 V330D probably damaging Het
Gfpt1 A G 6: 87,050,977 T22A probably benign Het
Gm3371 A G 14: 44,403,783 V108A Het
Gm8257 T C 14: 44,650,283 E215G probably benign Het
Gria1 T A 11: 57,189,808 S206T probably benign Het
Gria2 T C 3: 80,741,076 T118A probably benign Het
Hfe T G 13: 23,706,047 T248P probably damaging Het
Kdm5d T C Y: 941,491 W1231R probably benign Het
Ltbp2 C T 12: 84,830,175 D419N probably damaging Het
Mei1 G A 15: 82,095,908 A232T Het
Mgam G A 6: 40,757,439 E1473K possibly damaging Het
Mtbp A C 15: 55,562,959 E99A possibly damaging Het
Muc5b A T 7: 141,863,126 T3270S probably benign Het
Myl2 A G 5: 122,101,663 Y28C Het
Nrxn1 A G 17: 90,588,669 probably null Het
Ntn4 A G 10: 93,682,572 H247R probably benign Het
Numa1 T C 7: 102,009,128 V1568A probably benign Het
Nyap1 C T 5: 137,735,529 G414D probably damaging Het
Olfr1061 C A 2: 86,413,852 A67S probably benign Het
Olfr493 A G 7: 108,346,888 F31S probably damaging Het
Pdgfrb G A 18: 61,071,708 V547I possibly damaging Het
Pom121l12 A T 11: 14,599,962 M223L probably benign Het
Prps1l1 T C 12: 34,985,425 S180P possibly damaging Het
Ptprf A G 4: 118,257,492 S189P probably damaging Het
Radil G A 5: 142,485,480 R1014W probably damaging Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Rhbdl2 G C 4: 123,817,865 V132L probably benign Het
Slc15a2 G T 16: 36,751,845 T719K probably benign Het
Slc9a9 A G 9: 95,055,489 T465A possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Sv2a A T 3: 96,188,209 Y306F probably benign Het
Sv2c A T 13: 95,989,136 H364Q probably damaging Het
Tmem181a T A 17: 6,304,258 L401Q possibly damaging Het
Trav9d-4 A G 14: 52,983,843 Y98C probably damaging Het
Trim33 T A 3: 103,310,323 C195S probably damaging Het
Uroc1 T C 6: 90,338,833 Y191H probably damaging Het
Usp9y T C Y: 1,381,305 I839V probably benign Het
Vmn1r52 A T 6: 90,179,136 I141F probably benign Het
Vmn1r59 T C 7: 5,454,161 H200R probably damaging Het
Vmn2r68 A T 7: 85,232,399 M491K possibly damaging Het
Vmn2r74 T C 7: 85,957,422 I239V probably benign Het
Wrn A C 8: 33,268,911 C1006W probably damaging Het
Other mutations in Cyp2c68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Cyp2c68 APN 19 39712495 missense probably damaging 0.98
IGL00826:Cyp2c68 APN 19 39739505 missense possibly damaging 0.87
IGL01363:Cyp2c68 APN 19 39703427 missense probably benign 0.01
IGL01892:Cyp2c68 APN 19 39734344 missense probably benign 0.00
IGL02088:Cyp2c68 APN 19 39703521 splice site probably benign
IGL02422:Cyp2c68 APN 19 39734452 missense probably damaging 1.00
IGL03047:Cyp2c68 UTSW 19 39734460 missense probably benign 0.00
R0523:Cyp2c68 UTSW 19 39739429 missense probably benign 0.08
R0729:Cyp2c68 UTSW 19 39739550 splice site probably benign
R0975:Cyp2c68 UTSW 19 39703358 missense possibly damaging 0.85
R1117:Cyp2c68 UTSW 19 39712459 missense probably damaging 1.00
R1355:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1370:Cyp2c68 UTSW 19 39740956 missense probably damaging 1.00
R1436:Cyp2c68 UTSW 19 39741040 start codon destroyed probably null 1.00
R1564:Cyp2c68 UTSW 19 39735580 nonsense probably null
R1730:Cyp2c68 UTSW 19 39699275 missense possibly damaging 0.87
R1865:Cyp2c68 UTSW 19 39734289 missense probably benign 0.04
R1905:Cyp2c68 UTSW 19 39735582 missense probably benign 0.01
R1951:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R1952:Cyp2c68 UTSW 19 39712528 missense probably benign 0.22
R2224:Cyp2c68 UTSW 19 39735582 missense probably benign 0.34
R2230:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2231:Cyp2c68 UTSW 19 39699360 missense probably benign 0.07
R2866:Cyp2c68 UTSW 19 39689145 missense probably damaging 1.00
R3104:Cyp2c68 UTSW 19 39734313 missense probably benign
R4409:Cyp2c68 UTSW 19 39739452 missense probably damaging 0.98
R4575:Cyp2c68 UTSW 19 39734361 missense probably benign 0.21
R4620:Cyp2c68 UTSW 19 39712562 splice site probably null
R4684:Cyp2c68 UTSW 19 39699335 missense possibly damaging 0.48
R5023:Cyp2c68 UTSW 19 39712507 missense probably benign 0.01
R5410:Cyp2c68 UTSW 19 39699284 missense possibly damaging 0.65
R5513:Cyp2c68 UTSW 19 39703406 missense probably damaging 1.00
R5568:Cyp2c68 UTSW 19 39689082 missense probably benign 0.19
R5706:Cyp2c68 UTSW 19 39734318 missense possibly damaging 0.95
R5890:Cyp2c68 UTSW 19 39712492 missense probably damaging 1.00
R5897:Cyp2c68 UTSW 19 39712531 missense probably benign 0.01
R6007:Cyp2c68 UTSW 19 39734336 missense probably damaging 1.00
R6132:Cyp2c68 UTSW 19 39703414 missense possibly damaging 0.90
R6187:Cyp2c68 UTSW 19 39741008 missense probably benign 0.32
R6229:Cyp2c68 UTSW 19 39739178 missense probably benign 0.02
R6341:Cyp2c68 UTSW 19 39712489 missense possibly damaging 0.54
R7209:Cyp2c68 UTSW 19 39689205 missense probably damaging 1.00
R7330:Cyp2c68 UTSW 19 39689190 missense probably damaging 1.00
R7402:Cyp2c68 UTSW 19 39740874 missense probably benign 0.02
R7483:Cyp2c68 UTSW 19 39689137 missense probably benign 0.02
Z1088:Cyp2c68 UTSW 19 39739463 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AAGGAGAATCTGACCTGAACTTACC -3'
(R):5'- AGTTCTCTGGAAGAGGAAGGATTC -3'

Sequencing Primer
(F):5'- GAATCTGACCTGAACTTACCATTTG -3'
(R):5'- GAAGGATTCCGGTTTTTGACAAAG -3'
Posted On2019-09-13