Incidental Mutation 'R7375:Tmem81'
ID572310
Institutional Source Beutler Lab
Gene Symbol Tmem81
Ensembl Gene ENSMUSG00000048174
Gene Nametransmembrane protein 81
Synonyms4930429O20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R7375 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location132506230-132508639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 132507563 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 36 (V36L)
Ref Sequence ENSEMBL: ENSMUSP00000062565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000058167] [ENSMUST00000086521] [ENSMUST00000187505] [ENSMUST00000188789] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably benign
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000058167
AA Change: V36L

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000062565
Gene: ENSMUSG00000048174
AA Change: V36L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086521
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect possibly damaging
Transcript: ENSMUST00000188789
AA Change: V36L

PolyPhen 2 Score 0.763 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000139911
Gene: ENSMUSG00000048174
AA Change: V36L

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect probably benign
Transcript: ENSMUST00000190825
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190997
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a26 A T 19: 7,783,144 probably null Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Tmem81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Tmem81 APN 1 132507960 missense probably damaging 1.00
R0094:Tmem81 UTSW 1 132508049 missense probably benign 0.00
R0255:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0432:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0531:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0532:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0551:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0614:Tmem81 UTSW 1 132507731 missense probably benign 0.01
R0651:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0696:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0973:Tmem81 UTSW 1 132507924 missense probably damaging 1.00
R1663:Tmem81 UTSW 1 132507897 missense probably benign 0.05
R1750:Tmem81 UTSW 1 132507583 missense probably damaging 0.98
R1881:Tmem81 UTSW 1 132508210 unclassified probably benign
R2074:Tmem81 UTSW 1 132507906 missense probably damaging 0.98
R2121:Tmem81 UTSW 1 132508109 missense probably benign 0.00
R3003:Tmem81 UTSW 1 132508014 missense probably benign 0.38
R3789:Tmem81 UTSW 1 132508071 missense probably benign 0.03
R4638:Tmem81 UTSW 1 132508205 unclassified probably benign
R7162:Tmem81 UTSW 1 132507617 missense probably damaging 1.00
R7527:Tmem81 UTSW 1 132508146 missense probably benign 0.34
R7586:Tmem81 UTSW 1 132507773 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCTCAGGGCTATTCCAAGC -3'
(R):5'- CAGGATGTCTGAGCTGAGAC -3'

Sequencing Primer
(F):5'- CTGGAGGCTCTGTTGTGGTAC -3'
(R):5'- GAGACAGTTCAGCTCAAACGTCTTC -3'
Posted On2019-09-13