Mutagenetix > Incidental Mutation

Incidental Mutation 'R7375:Brinp3'

572311

Institutional Source

Beutler Lab

Gene Symbol

Brinp3

Ensembl Gene

ENSMUSG00000035131

Gene Name

bone morphogenetic protein/retinoic acid inducible neural specific 3

Synonyms

Fam5c, B830045N13Rik

MMRRC Submission

045458-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.152) question?

Stock #

R7375 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

146494760-146902472 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 146902010 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 732 (L732V)

Ref Sequence

ENSEMBL: ENSMUSP00000074201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]

AlphaFold

Q499E0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000074622
AA Change: L732V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: L732V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000128345

SMART Domains

Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166814
AA Change: L732V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: L732V

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
MACPF	78	264	7.69e-42	SMART
low complexity region	315	326	N/A	INTRINSIC
coiled coil region	349	372	N/A	INTRINSIC
EGF	440	475	1.73e1	SMART

Meta Mutation Damage Score

0.1041

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,918,671	I337V	probably benign	Het
Abl2	A	G	1: 156,622,614	D117G	probably damaging	Het
Arhgap5	T	A	12: 52,516,582	L112*	probably null	Het
Cmya5	T	G	13: 93,091,661	K2306N	probably damaging	Het
Col16a1	A	C	4: 130,065,501	K680T	unknown	Het
Col28a1	T	A	6: 7,998,499	T1137S	possibly damaging	Het
Crnn	A	T	3: 93,149,145	T413S	possibly damaging	Het
Csf1	A	G	3: 107,748,179	L512P	possibly damaging	Het
Dlx3	C	A	11: 95,120,635	A105D	possibly damaging	Het
Dnah3	T	G	7: 119,951,677	T161P	probably damaging	Het
Dnah7b	A	G	1: 46,303,634	D3435G	probably damaging	Het
Dpp10	A	G	1: 123,367,795	I541T	probably benign	Het
Efcc1	T	C	6: 87,751,856	V431A	possibly damaging	Het
Enpp5	T	C	17: 44,080,977	I99T	probably benign	Het
Fam192a	G	A	8: 94,583,008	L119F	probably benign	Het
Gm11232	C	T	4: 71,757,346	W59*	probably null	Het
Gm17660	G	T	5: 104,071,257		probably null	Het
Gm8251	A	T	1: 44,060,534	I468N	possibly damaging	Het
Gxylt2	A	T	6: 100,750,422	T166S	probably benign	Het
Herc6	A	T	6: 57,651,806		probably null	Het
Itga2	T	C	13: 114,869,217	I476V	probably benign	Het
Kcnq5	T	C	1: 21,469,486	T403A	possibly damaging	Het
Klhl42	A	G	6: 147,092,040	K170R	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Krt32	G	T	11: 100,081,224	R433S	probably benign	Het
Lrp1	G	T	10: 127,539,348	T4461N	probably damaging	Het
Maats1	T	A	16: 38,335,618	H81L	probably damaging	Het
Mapk10	A	T	5: 102,976,390	M256K	probably null	Het
Mogat2	T	C	7: 99,223,698	K93R	probably damaging	Het
Myh1	G	T	11: 67,210,428	V677L	probably damaging	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Olfr1242	C	T	2: 89,493,692	G207R	possibly damaging	Het
Oog4	G	A	4: 143,438,974	T201M	possibly damaging	Het
Pik3c2a	T	C	7: 116,376,386	T649A	probably damaging	Het
Plec	T	A	15: 76,177,355	H2794L	possibly damaging	Het
Pros1	T	A	16: 62,924,550	N509K	probably damaging	Het
Psme4	T	A	11: 30,772,700		probably null	Het
Ptprf	A	G	4: 118,212,814	V1457A	probably benign	Het
Rad50	A	G	11: 53,652,228		probably null	Het
Rfx5	C	T	3: 94,958,742	P451S	unknown	Het
Sdk1	G	T	5: 141,998,843	V728L	probably benign	Het
Sfxn4	T	C	19: 60,858,674	D57G	probably benign	Het
Slc10a4	A	G	5: 73,012,307	D425G	probably benign	Het
Slc17a5	C	T	9: 78,587,892	A26T	probably benign	Het
Slc22a26	A	T	19: 7,783,144		probably null	Het
Slc22a30	A	G	19: 8,404,691	L72P	probably damaging	Het
Slco6c1	T	C	1: 97,081,421	T447A	possibly damaging	Het
Slco6d1	A	G	1: 98,421,447	N81S	probably damaging	Het
Stard9	T	C	2: 120,665,002		probably null	Het
Tecpr1	T	C	5: 144,208,599	E610G	possibly damaging	Het
Tmem81	G	T	1: 132,507,563	V36L	possibly damaging	Het
Trabd2b	G	T	4: 114,609,997	K474N	probably benign	Het
Tspan33	T	C	6: 29,713,520	F149L	probably benign	Het
Ttn	A	G	2: 76,776,339	Y18076H	probably damaging	Het
Utrn	G	A	10: 12,641,020	R2277C	probably damaging	Het
Vmn2r101	T	A	17: 19,611,390	D549E	probably damaging	Het
Vmn2r107	T	A	17: 20,355,876	I156K	probably benign	Het
Wwc2	T	G	8: 47,863,920	S713R	unknown	Het
Xndc1	C	A	7: 102,081,480		probably null	Het
Zfp810	A	G	9: 22,290,537		probably null	Het

Other mutations in Brinp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Brinp3	APN	1	146901774	missense	probably damaging	0.99
IGL00503:Brinp3	APN	1	146901167	missense	probably benign
IGL01702:Brinp3	APN	1	146751997	splice site	probably benign
IGL01728:Brinp3	APN	1	146831551	splice site	probably null
IGL01733:Brinp3	APN	1	146514803	missense	probably benign	0.33
IGL01937:Brinp3	APN	1	146901140	missense	probably benign
IGL02020:Brinp3	APN	1	146902127	utr 3 prime	probably benign
IGL02082:Brinp3	APN	1	146751862	missense	probably damaging	1.00
IGL02365:Brinp3	APN	1	146901122	missense	probably benign	0.00
IGL02366:Brinp3	APN	1	146701743	missense	possibly damaging	0.84
IGL02565:Brinp3	APN	1	146902032	missense	probably damaging	0.98
IGL02999:Brinp3	APN	1	146701849	splice site	probably null
IGL03099:Brinp3	APN	1	146902097	missense	possibly damaging	0.91
PIT4283001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
PIT4418001:Brinp3	UTSW	1	146901423	missense	probably damaging	0.99
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0021:Brinp3	UTSW	1	146901451	missense	probably benign	0.04
R0266:Brinp3	UTSW	1	146682680	nonsense	probably null
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1468:Brinp3	UTSW	1	146901962	missense	probably benign	0.01
R1522:Brinp3	UTSW	1	146901890	missense	probably damaging	0.99
R1596:Brinp3	UTSW	1	146514782	missense	probably benign
R1898:Brinp3	UTSW	1	146901249	missense	possibly damaging	0.93
R2036:Brinp3	UTSW	1	146701841	missense	possibly damaging	0.84
R2224:Brinp3	UTSW	1	146901920	nonsense	probably null
R2272:Brinp3	UTSW	1	146901404	missense	possibly damaging	0.93
R2291:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R2322:Brinp3	UTSW	1	146701754	missense	probably benign
R2880:Brinp3	UTSW	1	146902002	missense	probably damaging	0.98
R3918:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3939:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3940:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3941:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R3942:Brinp3	UTSW	1	146751861	missense	probably damaging	0.99
R4095:Brinp3	UTSW	1	146901692	missense	possibly damaging	0.72
R4783:Brinp3	UTSW	1	146727640	intron	probably benign
R5009:Brinp3	UTSW	1	146901049	missense	probably benign	0.25
R5034:Brinp3	UTSW	1	146727720	intron	probably benign
R5166:Brinp3	UTSW	1	146901367	missense	probably damaging	0.96
R5372:Brinp3	UTSW	1	146831726	missense	probably damaging	1.00
R5472:Brinp3	UTSW	1	146901459	missense	possibly damaging	0.86
R5651:Brinp3	UTSW	1	146701799	missense	probably benign	0.01
R5681:Brinp3	UTSW	1	146901746	missense	probably benign	0.12
R6351:Brinp3	UTSW	1	146901585	missense	probably damaging	0.96
R6470:Brinp3	UTSW	1	146901906	missense	probably damaging	0.99
R6499:Brinp3	UTSW	1	146901693	missense	possibly damaging	0.86
R7078:Brinp3	UTSW	1	146514889	nonsense	probably null
R7223:Brinp3	UTSW	1	146901074	missense	possibly damaging	0.85
R7322:Brinp3	UTSW	1	146682688	nonsense	probably null
R7347:Brinp3	UTSW	1	146902086	missense	probably benign	0.22
R7412:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7532:Brinp3	UTSW	1	146901401	missense	probably damaging	0.98
R7562:Brinp3	UTSW	1	146902010	missense	possibly damaging	0.91
R7576:Brinp3	UTSW	1	146901563	missense	probably damaging	0.99
R7723:Brinp3	UTSW	1	146701671	missense	probably damaging	1.00
R7737:Brinp3	UTSW	1	146682594	missense	probably damaging	0.98
R7793:Brinp3	UTSW	1	146746568	missense	probably benign	0.20
R8334:Brinp3	UTSW	1	146902053	missense	probably damaging	0.99
R8401:Brinp3	UTSW	1	146901446	missense	probably benign	0.17
R9205:Brinp3	UTSW	1	146902089	missense	possibly damaging	0.57
R9328:Brinp3	UTSW	1	146831717	missense	probably damaging	0.98
R9602:Brinp3	UTSW	1	146746496	missense	probably damaging	1.00
X0060:Brinp3	UTSW	1	146901786	missense	probably benign	0.01
Z1176:Brinp3	UTSW	1	146902076	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTGACCCTGAAGCCATTCGG -3'
(R):5'- GCCATCCAACGTTATTGACTG -3'

Sequencing Primer
(F):5'- AAGCCATTCGGGACCTGATTTTG -3'
(R):5'- TCCAACGTTATTGACTGATATAAGAC -3'

Posted On

2019-09-13