Incidental Mutation 'R7375:Brinp3'
ID572311
Institutional Source Beutler Lab
Gene Symbol Brinp3
Ensembl Gene ENSMUSG00000035131
Gene Namebone morphogenetic protein/retinoic acid inducible neural specific 3
SynonymsFam5c, B830045N13Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R7375 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location146494760-146902472 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 146902010 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 732 (L732V)
Ref Sequence ENSEMBL: ENSMUSP00000074201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074622] [ENSMUST00000128345] [ENSMUST00000166814]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074622
AA Change: L732V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074201
Gene: ENSMUSG00000035131
AA Change: L732V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128345
SMART Domains Protein: ENSMUSP00000116763
Gene: ENSMUSG00000035131

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000166814
AA Change: L732V

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126074
Gene: ENSMUSG00000035131
AA Change: L732V

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
MACPF 78 264 7.69e-42 SMART
low complexity region 315 326 N/A INTRINSIC
coiled coil region 349 372 N/A INTRINSIC
EGF 440 475 1.73e1 SMART
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is overexpressed in pituitary tumors but is underexpressed in tongue squamous cell carcinomas, ulcerative colitis, and peri-implantitis. Polymorphisms that increase expression of this gene have been shown to increase vascular inflammation, and an association of this gene with myocardial infarction has been demonstrated. Finally, hypermethylation of this gene may find usefulness as a biomarker for gastric cancer. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a26 A T 19: 7,783,144 probably null Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Brinp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Brinp3 APN 1 146901774 missense probably damaging 0.99
IGL00503:Brinp3 APN 1 146901167 missense probably benign
IGL01702:Brinp3 APN 1 146751997 splice site probably benign
IGL01728:Brinp3 APN 1 146831551 splice site probably null
IGL01733:Brinp3 APN 1 146514803 missense probably benign 0.33
IGL01937:Brinp3 APN 1 146901140 missense probably benign
IGL02020:Brinp3 APN 1 146902127 utr 3 prime probably benign
IGL02082:Brinp3 APN 1 146751862 missense probably damaging 1.00
IGL02365:Brinp3 APN 1 146901122 missense probably benign 0.00
IGL02366:Brinp3 APN 1 146701743 missense possibly damaging 0.84
IGL02565:Brinp3 APN 1 146902032 missense probably damaging 0.98
IGL02999:Brinp3 APN 1 146701849 splice site probably null
IGL03099:Brinp3 APN 1 146902097 missense possibly damaging 0.91
PIT4283001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
PIT4418001:Brinp3 UTSW 1 146901423 missense probably damaging 0.99
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0021:Brinp3 UTSW 1 146901451 missense probably benign 0.04
R0266:Brinp3 UTSW 1 146682680 nonsense probably null
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1468:Brinp3 UTSW 1 146901962 missense probably benign 0.01
R1522:Brinp3 UTSW 1 146901890 missense probably damaging 0.99
R1596:Brinp3 UTSW 1 146514782 missense probably benign
R1898:Brinp3 UTSW 1 146901249 missense possibly damaging 0.93
R2036:Brinp3 UTSW 1 146701841 missense possibly damaging 0.84
R2224:Brinp3 UTSW 1 146901920 nonsense probably null
R2272:Brinp3 UTSW 1 146901404 missense possibly damaging 0.93
R2291:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R2322:Brinp3 UTSW 1 146701754 missense probably benign
R2880:Brinp3 UTSW 1 146902002 missense probably damaging 0.98
R3918:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3939:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3940:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3941:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R3942:Brinp3 UTSW 1 146751861 missense probably damaging 0.99
R4095:Brinp3 UTSW 1 146901692 missense possibly damaging 0.72
R4783:Brinp3 UTSW 1 146727640 intron probably benign
R5009:Brinp3 UTSW 1 146901049 missense probably benign 0.25
R5034:Brinp3 UTSW 1 146727720 intron probably benign
R5166:Brinp3 UTSW 1 146901367 missense probably damaging 0.96
R5372:Brinp3 UTSW 1 146831726 missense probably damaging 1.00
R5472:Brinp3 UTSW 1 146901459 missense possibly damaging 0.86
R5651:Brinp3 UTSW 1 146701799 missense probably benign 0.01
R5681:Brinp3 UTSW 1 146901746 missense probably benign 0.12
R6351:Brinp3 UTSW 1 146901585 missense probably damaging 0.96
R6470:Brinp3 UTSW 1 146901906 missense probably damaging 0.99
R6499:Brinp3 UTSW 1 146901693 missense possibly damaging 0.86
R7078:Brinp3 UTSW 1 146514889 nonsense probably null
R7223:Brinp3 UTSW 1 146901074 missense possibly damaging 0.85
R7322:Brinp3 UTSW 1 146682688 nonsense probably null
R7347:Brinp3 UTSW 1 146902086 missense probably benign 0.22
R7412:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7532:Brinp3 UTSW 1 146901401 missense probably damaging 0.98
R7562:Brinp3 UTSW 1 146902010 missense possibly damaging 0.91
R7576:Brinp3 UTSW 1 146901563 missense probably damaging 0.99
R7723:Brinp3 UTSW 1 146701671 missense probably damaging 1.00
R7737:Brinp3 UTSW 1 146682594 missense probably damaging 0.98
R7793:Brinp3 UTSW 1 146746568 missense probably benign 0.20
X0060:Brinp3 UTSW 1 146901786 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGACCCTGAAGCCATTCGG -3'
(R):5'- GCCATCCAACGTTATTGACTG -3'

Sequencing Primer
(F):5'- AAGCCATTCGGGACCTGATTTTG -3'
(R):5'- TCCAACGTTATTGACTGATATAAGAC -3'
Posted On2019-09-13