Incidental Mutation 'R7375:Trabd2b'
ID572319
Institutional Source Beutler Lab
Gene Symbol Trabd2b
Ensembl Gene ENSMUSG00000070867
Gene NameTraB domain containing 2B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R7375 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location114406724-114615098 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 114609997 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 474 (K474N)
Ref Sequence ENSEMBL: ENSMUSP00000092494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094894]
Predicted Effect probably benign
Transcript: ENSMUST00000094894
AA Change: K474N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092494
Gene: ENSMUSG00000070867
AA Change: K474N

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:TraB 41 350 6.2e-67 PFAM
low complexity region 359 402 N/A INTRINSIC
low complexity region 404 419 N/A INTRINSIC
low complexity region 450 469 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a26 A T 19: 7,783,144 probably null Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Trabd2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Trabd2b APN 4 114409125 missense probably damaging 0.99
IGL01404:Trabd2b APN 4 114599956 missense probably benign 0.01
IGL01866:Trabd2b APN 4 114408920 missense probably damaging 0.96
IGL03056:Trabd2b APN 4 114409338 missense probably damaging 0.96
IGL03167:Trabd2b APN 4 114609998 missense probably benign
E0374:Trabd2b UTSW 4 114599897 missense probably damaging 0.99
R0645:Trabd2b UTSW 4 114586570 missense probably damaging 1.00
R0744:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R0833:Trabd2b UTSW 4 114580322 missense probably benign 0.00
R1580:Trabd2b UTSW 4 114580334 missense possibly damaging 0.91
R1599:Trabd2b UTSW 4 114408981 missense probably damaging 0.99
R2132:Trabd2b UTSW 4 114610008 missense probably benign
R2133:Trabd2b UTSW 4 114610008 missense probably benign
R2204:Trabd2b UTSW 4 114602994 missense probably damaging 1.00
R2518:Trabd2b UTSW 4 114599903 missense probably damaging 1.00
R4940:Trabd2b UTSW 4 114408944 missense probably damaging 1.00
R4994:Trabd2b UTSW 4 114406855 missense probably benign 0.05
R5104:Trabd2b UTSW 4 114406917 missense probably benign 0.21
R5219:Trabd2b UTSW 4 114602810 missense probably damaging 0.97
R6456:Trabd2b UTSW 4 114586560 missense probably damaging 1.00
R7148:Trabd2b UTSW 4 114409350 missense probably damaging 1.00
R7192:Trabd2b UTSW 4 114610020 missense possibly damaging 0.88
R7195:Trabd2b UTSW 4 114409440 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGGTTCCAGACTATTCCTC -3'
(R):5'- AACTGCCTTGAGGGTGTTAGC -3'

Sequencing Primer
(F):5'- AGACTATTCCTCCTCCCTAAGGTAC -3'
(R):5'- ACCATCTGAGGTGGTGTCAG -3'
Posted On2019-09-13