Incidental Mutation 'R7375:Col16a1'
ID572321
Institutional Source Beutler Lab
Gene Symbol Col16a1
Ensembl Gene ENSMUSG00000040690
Gene Namecollagen, type XVI, alpha 1
Synonyms2700007F12Rik, [a]1 (XVI) collagen, A530052M23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R7375 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location130047840-130099283 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 130065501 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 680 (K680T)
Ref Sequence ENSEMBL: ENSMUSP00000035802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044565] [ENSMUST00000143432] [ENSMUST00000143577]
Predicted Effect unknown
Transcript: ENSMUST00000044565
AA Change: K680T
SMART Domains Protein: ENSMUSP00000035802
Gene: ENSMUSG00000040690
AA Change: K680T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_4 330 355 2.35e-7 PROSPERO
Pfam:Collagen 372 431 1.6e-8 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_2 546 562 2.68e-9 PROSPERO
internal_repeat_1 547 580 9.92e-10 PROSPERO
Pfam:Collagen 584 646 1.5e-9 PFAM
internal_repeat_5 662 689 6.35e-7 PROSPERO
internal_repeat_3 662 731 1.96e-8 PROSPERO
internal_repeat_7 679 695 2.06e-5 PROSPERO
internal_repeat_6 682 730 7.63e-6 PROSPERO
internal_repeat_1 685 742 9.92e-10 PROSPERO
Pfam:Collagen 796 850 3.4e-9 PFAM
internal_repeat_5 859 889 6.35e-7 PROSPERO
low complexity region 891 922 N/A INTRINSIC
low complexity region 990 1000 N/A INTRINSIC
Pfam:Collagen 1001 1064 1.4e-10 PFAM
low complexity region 1090 1112 N/A INTRINSIC
internal_repeat_7 1114 1130 2.06e-5 PROSPERO
low complexity region 1132 1162 N/A INTRINSIC
low complexity region 1171 1222 N/A INTRINSIC
low complexity region 1230 1282 N/A INTRINSIC
internal_repeat_2 1283 1299 2.68e-9 PROSPERO
internal_repeat_6 1287 1335 7.63e-6 PROSPERO
Pfam:Collagen 1350 1411 1.8e-9 PFAM
Pfam:Collagen 1446 1503 5.3e-10 PFAM
low complexity region 1505 1525 N/A INTRINSIC
low complexity region 1528 1549 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000143432
AA Change: K680T
SMART Domains Protein: ENSMUSP00000120384
Gene: ENSMUSG00000040690
AA Change: K680T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
TSPN 50 231 1.07e-68 SMART
internal_repeat_1 330 353 5.41e-8 PROSPERO
Pfam:Collagen 372 426 2.1e-9 PFAM
low complexity region 441 507 N/A INTRINSIC
low complexity region 525 542 N/A INTRINSIC
internal_repeat_1 546 569 5.41e-8 PROSPERO
internal_repeat_2 547 580 5.41e-8 PROSPERO
Pfam:Collagen 584 646 2.7e-10 PFAM
Pfam:Collagen 659 736 8.6e-8 PFAM
Pfam:Collagen 745 797 1.6e-7 PFAM
Pfam:Collagen 796 850 5.9e-10 PFAM
Pfam:Collagen 848 923 1.6e-7 PFAM
low complexity region 974 984 N/A INTRINSIC
Pfam:Collagen 987 1045 1e-11 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000143577
AA Change: K365T
SMART Domains Protein: ENSMUSP00000120339
Gene: ENSMUSG00000040690
AA Change: K365T

DomainStartEndE-ValueType
internal_repeat_7 1 43 5.7e-5 PROSPERO
Pfam:Collagen 57 112 2e-9 PFAM
low complexity region 126 192 N/A INTRINSIC
low complexity region 210 227 N/A INTRINSIC
internal_repeat_2 231 247 1.5e-10 PROSPERO
internal_repeat_1 232 265 5.16e-11 PROSPERO
Pfam:Collagen 269 331 3.4e-10 PFAM
Pfam:Collagen 360 421 7e-11 PFAM
Pfam:Collagen 430 482 1.9e-7 PFAM
Pfam:Collagen 481 535 7.8e-10 PFAM
Pfam:Collagen 560 623 1.4e-7 PFAM
internal_repeat_9 640 665 9.73e-5 PROSPERO
low complexity region 675 685 N/A INTRINSIC
Pfam:Collagen 686 747 2.5e-11 PFAM
Pfam:Collagen 730 802 5.2e-9 PFAM
Pfam:Collagen 783 860 9.2e-9 PFAM
low complexity region 871 922 N/A INTRINSIC
low complexity region 930 985 N/A INTRINSIC
internal_repeat_2 986 1002 1.5e-10 PROSPERO
internal_repeat_5 990 1038 7.88e-7 PROSPERO
low complexity region 1041 1110 N/A INTRINSIC
Pfam:Collagen 1149 1205 1.8e-10 PFAM
Pfam:Collagen 1203 1260 1.1e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XVI collagen, a member of the FACIT collagen family (fibril-associated collagens with interrupted helices). Members of this collagen family are found in association with fibril-forming collagens such as type I and II, and serve to maintain the integrity of the extracellular matrix. High levels of type XVI collagen have been found in fibroblasts and keratinocytes, and in smooth muscle and amnion. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Arhgap5 T A 12: 52,516,582 L112* probably null Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a26 A T 19: 7,783,144 probably null Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Col16a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Col16a1 APN 4 130094552 splice site probably null
IGL00885:Col16a1 APN 4 130096910 missense probably damaging 1.00
IGL01931:Col16a1 APN 4 130072841 missense possibly damaging 0.47
IGL02142:Col16a1 APN 4 130051647 splice site probably null
IGL02307:Col16a1 APN 4 130059009 missense probably damaging 1.00
IGL02731:Col16a1 APN 4 130053530 unclassified probably benign
IGL02742:Col16a1 APN 4 130061379 unclassified probably benign
PIT4520001:Col16a1 UTSW 4 130051663 missense unknown
R0127:Col16a1 UTSW 4 130052857 missense probably damaging 1.00
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0131:Col16a1 UTSW 4 130067096 missense unknown
R0132:Col16a1 UTSW 4 130067096 missense unknown
R0299:Col16a1 UTSW 4 130058318 frame shift probably null
R0355:Col16a1 UTSW 4 130058413 splice site probably benign
R0395:Col16a1 UTSW 4 130073109 missense probably damaging 1.00
R0485:Col16a1 UTSW 4 130090497 splice site probably benign
R0573:Col16a1 UTSW 4 130068475 splice site probably benign
R1274:Col16a1 UTSW 4 130097801 missense probably damaging 0.98
R1619:Col16a1 UTSW 4 130098940 missense probably damaging 1.00
R1759:Col16a1 UTSW 4 130084269 missense probably damaging 1.00
R1832:Col16a1 UTSW 4 130077057 splice site probably null
R1861:Col16a1 UTSW 4 130061724 unclassified probably benign
R1862:Col16a1 UTSW 4 130092782 critical splice donor site probably null
R1981:Col16a1 UTSW 4 130065443 missense unknown
R2265:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2269:Col16a1 UTSW 4 130052918 missense probably benign 0.02
R2291:Col16a1 UTSW 4 130067040 missense unknown
R3176:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3276:Col16a1 UTSW 4 130057999 missense probably damaging 0.99
R3552:Col16a1 UTSW 4 130077041 missense probably benign 0.10
R4049:Col16a1 UTSW 4 130068752 missense probably damaging 1.00
R4241:Col16a1 UTSW 4 130099050 missense probably damaging 0.98
R4327:Col16a1 UTSW 4 130094551 critical splice donor site probably null
R4591:Col16a1 UTSW 4 130061799 splice site probably null
R4664:Col16a1 UTSW 4 130062090 unclassified probably benign
R4803:Col16a1 UTSW 4 130055108 unclassified probably benign
R4925:Col16a1 UTSW 4 130054176 missense probably damaging 1.00
R4961:Col16a1 UTSW 4 130054479 splice site probably null
R5016:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5027:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5085:Col16a1 UTSW 4 130054171 missense probably damaging 1.00
R5088:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5089:Col16a1 UTSW 4 130079195 missense probably benign 0.31
R5408:Col16a1 UTSW 4 130093105 utr 3 prime probably benign
R5472:Col16a1 UTSW 4 130092771 utr 3 prime probably benign
R5564:Col16a1 UTSW 4 130053358 missense probably damaging 1.00
R5597:Col16a1 UTSW 4 130058304 missense probably damaging 1.00
R5703:Col16a1 UTSW 4 130053299 missense probably damaging 0.96
R6054:Col16a1 UTSW 4 130061722 unclassified probably benign
R6226:Col16a1 UTSW 4 130055089 unclassified probably benign
R6362:Col16a1 UTSW 4 130066190 missense unknown
R6448:Col16a1 UTSW 4 130058988 missense probably damaging 1.00
R6449:Col16a1 UTSW 4 130066693 missense unknown
R6502:Col16a1 UTSW 4 130055994 missense probably damaging 1.00
R6949:Col16a1 UTSW 4 130059323 missense probably damaging 1.00
R6969:Col16a1 UTSW 4 130093087 utr 3 prime probably benign
R7086:Col16a1 UTSW 4 130052980 splice site probably null
R7703:Col16a1 UTSW 4 130096502 missense unknown
R7808:Col16a1 UTSW 4 130073264 missense unknown
R7904:Col16a1 UTSW 4 130054208 nonsense probably null
R7987:Col16a1 UTSW 4 130054208 nonsense probably null
RF014:Col16a1 UTSW 4 130093067 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCTCAGGTTGCAGGAAC -3'
(R):5'- TTTAAATCGGAACCAGCTTGGAAC -3'

Sequencing Primer
(F):5'- GTTGCAGGAACCCCTTAACC -3'
(R):5'- ACCATTCTATGTCCCAGGATGAAGG -3'
Posted On2019-09-13