Mutagenetix > Incidental Mutation

Incidental Mutation 'R7375:Tecpr1'

572327

Institutional Source

Beutler Lab

Gene Symbol

Tecpr1

Ensembl Gene

ENSMUSG00000066621

Gene Name

tectonin beta-propeller repeat containing 1

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7375 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

144194442-144223615 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 144208599 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 610 (E610G)

Ref Sequence

ENSEMBL: ENSMUSP00000082844 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085701]

AlphaFold

Q80VP0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000085701
AA Change: E610G

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000082844
Gene: ENSMUSG00000066621
AA Change: E610G

Domain	Start	End	E-Value	Type
TECPR	23	59	8.98e1	SMART
DysFN	64	125	6.72e-24	SMART
DysFC	137	170	1.89e-9	SMART
TECPR	192	225	1.79e-1	SMART
TECPR	234	270	2.5e-9	SMART
TECPR	279	317	4.99e-9	SMART
TECPR	326	361	2.42e-7	SMART
low complexity region	381	394	N/A	INTRINSIC
PH	614	724	1.69e-2	SMART
TECPR	711	750	1.88e-4	SMART
TECPR	766	800	3.27e-4	SMART
DysFN	821	882	2.95e-20	SMART
DysFC	893	926	1.66e-14	SMART
TECPR	940	974	1.69e1	SMART
TECPR	983	1019	1.45e-5	SMART
TECPR	1028	1065	1.51e-8	SMART
TECPR	1074	1109	1.59e-2	SMART
low complexity region	1125	1137	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tethering factor involved in autophagy. The encoded protein is found at autolysosomes, and is involved in targeting protein aggregates, damaged mitochondria, and bacterial pathogens for autophagy [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired selective autophagy and abnormal response to bacterial infection in MEFs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb4	A	G	5: 8,918,671	I337V	probably benign	Het
Abl2	A	G	1: 156,622,614	D117G	probably damaging	Het
Arhgap5	T	A	12: 52,516,582	L112*	probably null	Het
Brinp3	C	G	1: 146,902,010	L732V	possibly damaging	Het
Cmya5	T	G	13: 93,091,661	K2306N	probably damaging	Het
Col16a1	A	C	4: 130,065,501	K680T	unknown	Het
Col28a1	T	A	6: 7,998,499	T1137S	possibly damaging	Het
Crnn	A	T	3: 93,149,145	T413S	possibly damaging	Het
Csf1	A	G	3: 107,748,179	L512P	possibly damaging	Het
Dlx3	C	A	11: 95,120,635	A105D	possibly damaging	Het
Dnah3	T	G	7: 119,951,677	T161P	probably damaging	Het
Dnah7b	A	G	1: 46,303,634	D3435G	probably damaging	Het
Dpp10	A	G	1: 123,367,795	I541T	probably benign	Het
Efcc1	T	C	6: 87,751,856	V431A	possibly damaging	Het
Enpp5	T	C	17: 44,080,977	I99T	probably benign	Het
Fam192a	G	A	8: 94,583,008	L119F	probably benign	Het
Gm11232	C	T	4: 71,757,346	W59*	probably null	Het
Gm17660	G	T	5: 104,071,257		probably null	Het
Gm8251	A	T	1: 44,060,534	I468N	possibly damaging	Het
Gxylt2	A	T	6: 100,750,422	T166S	probably benign	Het
Herc6	A	T	6: 57,651,806		probably null	Het
Itga2	T	C	13: 114,869,217	I476V	probably benign	Het
Kcnq5	T	C	1: 21,469,486	T403A	possibly damaging	Het
Klhl42	A	G	6: 147,092,040	K170R	probably benign	Het
Klk13	T	C	7: 43,721,158		probably null	Het
Krt32	G	T	11: 100,081,224	R433S	probably benign	Het
Lrp1	G	T	10: 127,539,348	T4461N	probably damaging	Het
Maats1	T	A	16: 38,335,618	H81L	probably damaging	Het
Mapk10	A	T	5: 102,976,390	M256K	probably null	Het
Mogat2	T	C	7: 99,223,698	K93R	probably damaging	Het
Myh1	G	T	11: 67,210,428	V677L	probably damaging	Het
Naip5	T	C	13: 100,219,696	Q1137R	probably benign	Het
Naip5	G	T	13: 100,219,697	Q1137K	not run	Het
Olfr1242	C	T	2: 89,493,692	G207R	possibly damaging	Het
Oog4	G	A	4: 143,438,974	T201M	possibly damaging	Het
Pik3c2a	T	C	7: 116,376,386	T649A	probably damaging	Het
Plec	T	A	15: 76,177,355	H2794L	possibly damaging	Het
Pros1	T	A	16: 62,924,550	N509K	probably damaging	Het
Psme4	T	A	11: 30,772,700		probably null	Het
Ptprf	A	G	4: 118,212,814	V1457A	probably benign	Het
Rad50	A	G	11: 53,652,228		probably null	Het
Rfx5	C	T	3: 94,958,742	P451S	unknown	Het
Sdk1	G	T	5: 141,998,843	V728L	probably benign	Het
Sfxn4	T	C	19: 60,858,674	D57G	probably benign	Het
Slc10a4	A	G	5: 73,012,307	D425G	probably benign	Het
Slc17a5	C	T	9: 78,587,892	A26T	probably benign	Het
Slc22a26	A	T	19: 7,783,144		probably null	Het
Slc22a30	A	G	19: 8,404,691	L72P	probably damaging	Het
Slco6c1	T	C	1: 97,081,421	T447A	possibly damaging	Het
Slco6d1	A	G	1: 98,421,447	N81S	probably damaging	Het
Stard9	T	C	2: 120,665,002		probably null	Het
Tmem81	G	T	1: 132,507,563	V36L	possibly damaging	Het
Trabd2b	G	T	4: 114,609,997	K474N	probably benign	Het
Tspan33	T	C	6: 29,713,520	F149L	probably benign	Het
Ttn	A	G	2: 76,776,339	Y18076H	probably damaging	Het
Utrn	G	A	10: 12,641,020	R2277C	probably damaging	Het
Vmn2r101	T	A	17: 19,611,390	D549E	probably damaging	Het
Vmn2r107	T	A	17: 20,355,876	I156K	probably benign	Het
Wwc2	T	G	8: 47,863,920	S713R	unknown	Het
Xndc1	C	A	7: 102,081,480		probably null	Het
Zfp810	A	G	9: 22,290,537		probably null	Het

Other mutations in Tecpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01399:Tecpr1	APN	5	144208593	critical splice donor site	probably null
IGL01774:Tecpr1	APN	5	144211540	missense	probably damaging	0.97
IGL01960:Tecpr1	APN	5	144216919	missense	probably benign	0.00
IGL01973:Tecpr1	APN	5	144197988	splice site	probably benign
IGL02244:Tecpr1	APN	5	144210003	missense	probably benign
IGL02247:Tecpr1	APN	5	144206554	missense	possibly damaging	0.64
IGL02423:Tecpr1	APN	5	144203487	missense	possibly damaging	0.88
IGL02679:Tecpr1	APN	5	144206546	missense	probably benign	0.28
larghissimo	UTSW	5	144217257	missense	probably damaging	1.00
PIT4531001:Tecpr1	UTSW	5	144214067	missense	probably damaging	0.96
R0121:Tecpr1	UTSW	5	144210199	missense	probably benign	0.02
R0125:Tecpr1	UTSW	5	144197899	missense	probably damaging	1.00
R0194:Tecpr1	UTSW	5	144218517	missense	probably damaging	1.00
R0376:Tecpr1	UTSW	5	144207476	missense	possibly damaging	0.94
R0441:Tecpr1	UTSW	5	144195941	missense	probably benign
R0504:Tecpr1	UTSW	5	144214081	missense	probably damaging	0.99
R0538:Tecpr1	UTSW	5	144206274	missense	probably damaging	0.99
R0586:Tecpr1	UTSW	5	144217401	missense	probably damaging	1.00
R0607:Tecpr1	UTSW	5	144212590	missense	probably damaging	1.00
R0608:Tecpr1	UTSW	5	144211499	missense	probably damaging	1.00
R0656:Tecpr1	UTSW	5	144214053	splice site	probably null
R0835:Tecpr1	UTSW	5	144212592	missense	possibly damaging	0.81
R1080:Tecpr1	UTSW	5	144216929	missense	probably damaging	1.00
R1394:Tecpr1	UTSW	5	144206539	missense	possibly damaging	0.77
R1597:Tecpr1	UTSW	5	144214310	missense	probably benign	0.00
R1663:Tecpr1	UTSW	5	144197944	missense	probably benign	0.17
R1785:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1786:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R1833:Tecpr1	UTSW	5	144208608	missense	probably damaging	0.99
R1883:Tecpr1	UTSW	5	144206529	missense	probably benign	0.03
R1988:Tecpr1	UTSW	5	144204697	missense	possibly damaging	0.94
R2130:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2131:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2132:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2133:Tecpr1	UTSW	5	144208645	missense	probably benign	0.01
R2172:Tecpr1	UTSW	5	144196417	missense	probably damaging	1.00
R2172:Tecpr1	UTSW	5	144211456	missense	probably benign	0.10
R2290:Tecpr1	UTSW	5	144214063	missense	probably damaging	0.99
R3691:Tecpr1	UTSW	5	144209979	missense	probably benign	0.10
R4027:Tecpr1	UTSW	5	144206259	missense	probably benign	0.41
R4587:Tecpr1	UTSW	5	144212590	missense	probably damaging	0.96
R4684:Tecpr1	UTSW	5	144207437	missense	probably benign	0.16
R4864:Tecpr1	UTSW	5	144214117	missense	probably benign	0.00
R4932:Tecpr1	UTSW	5	144204658	missense	probably damaging	0.97
R4955:Tecpr1	UTSW	5	144217257	missense	probably damaging	1.00
R5043:Tecpr1	UTSW	5	144197854	splice site	probably null
R5459:Tecpr1	UTSW	5	144207416	missense	probably damaging	1.00
R5579:Tecpr1	UTSW	5	144214344	missense	possibly damaging	0.55
R5677:Tecpr1	UTSW	5	144218633	nonsense	probably null
R5679:Tecpr1	UTSW	5	144207423	missense	possibly damaging	0.69
R5802:Tecpr1	UTSW	5	144206546	missense	probably benign	0.28
R6000:Tecpr1	UTSW	5	144211421	missense	probably benign	0.02
R6022:Tecpr1	UTSW	5	144199191	missense	possibly damaging	0.95
R6114:Tecpr1	UTSW	5	144204640	missense	possibly damaging	0.81
R6251:Tecpr1	UTSW	5	144198576	missense	probably damaging	0.97
R6372:Tecpr1	UTSW	5	144216958	missense	probably damaging	1.00
R6493:Tecpr1	UTSW	5	144209974	missense	probably benign
R7276:Tecpr1	UTSW	5	144217020	nonsense	probably null
R7314:Tecpr1	UTSW	5	144217332	missense	probably damaging	1.00
R7632:Tecpr1	UTSW	5	144218726	missense	probably benign	0.03
R7702:Tecpr1	UTSW	5	144203418	missense	probably damaging	1.00
R8135:Tecpr1	UTSW	5	144198602	missense	probably damaging	0.99
R8406:Tecpr1	UTSW	5	144200840	missense	probably damaging	1.00
R8844:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8856:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8857:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8866:Tecpr1	UTSW	5	144216299	missense	possibly damaging	0.94
R8903:Tecpr1	UTSW	5	144214027	intron	probably benign
R8926:Tecpr1	UTSW	5	144216962	missense	probably damaging	1.00
R9218:Tecpr1	UTSW	5	144217231	missense	possibly damaging	0.70
R9423:Tecpr1	UTSW	5	144218578	missense	probably damaging	0.98
RF001:Tecpr1	UTSW	5	144217386	missense	probably damaging	0.99
Z1176:Tecpr1	UTSW	5	144218591	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TCTTTAACCTTGGGACTGCC -3'
(R):5'- TCAAGGTGACTGTCAGACGG -3'

Sequencing Primer
(F):5'- ATACGGCAGTGCGATCAC -3'
(R):5'- TGACTGTCAGACGGGCCATC -3'

Posted On

2019-09-13