Mutagenetix > Incidental Mutation

Incidental Mutation 'R0646:Sorcs3'

57233

Institutional Source

Beutler Lab

Gene Symbol

Sorcs3

Ensembl Gene

ENSMUSG00000063434

Gene Name

sortilin-related VPS10 domain containing receptor 3

Synonyms

6330404A12Rik

MMRRC Submission

038831-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.106) question?

Stock #

R0646 (G1)

Quality Score

125

Status

Not validated

Chromosome

Chromosomal Location

48206025-48805505 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 48206295 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glutamic Acid at position 39 (A39E)

Ref Sequence

ENSEMBL: ENSMUSP00000077919 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078880]

AlphaFold

Q8VI51

Predicted Effect

probably benign
Transcript: ENSMUST00000078880
AA Change: A39E

PolyPhen 2 Score 0.103 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000077919
Gene: ENSMUSG00000063434
AA Change: A39E

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	46	63	N/A	INTRINSIC
low complexity region	69	91	N/A	INTRINSIC
VPS10	216	818	N/A	SMART
Pfam:PKD	823	901	8e-13	PFAM
transmembrane domain	1122	1141	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

95% (123/130)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I receptor transmembrane protein that is a member of the vacuolar protein sorting 10 receptor family. Proteins of this family are defined by a vacuolar protein sorting 10 domain at the N-terminus. The N-terminal segment of this domain has a consensus motif for proprotein convertase processing, and the C-terminal segment of this domain is characterized by ten conserved cysteine residues. The vacuolar protein sorting 10 domain is followed by a leucine-rich segment, a transmembrane domain, and a short C-terminal cytoplasmic domain that interacts with adaptor molecules. The transcript is expressed at high levels in the brain, and candidate gene studies suggest that genetic variation in this gene is associated with Alzheimer's disease. Consistent with this observation, knockdown of the gene in cell culture results in an increase in amyloid precursor protein processing. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit absent NMDA and glutamate receptor-dependent long term depression, impaired spatial learning and memory and impaired fear memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 125 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	C	T	11: 23,575,491	R716H	probably damaging	Het
4930432E11Rik	C	T	7: 29,561,285		noncoding transcript	Het
A430078G23Rik	T	C	8: 3,386,959	Y250H	probably damaging	Het
Abcb11	A	G	2: 69,285,283	I579T	probably damaging	Het
Abcc9	T	C	6: 142,682,104	N400S	probably benign	Het
Adarb2	T	C	13: 8,731,819	L577P	probably damaging	Het
Agt	A	C	8: 124,557,113	N422K	probably damaging	Het
Ahnak	A	T	19: 9,013,402	K4017*	probably null	Het
Akap13	C	A	7: 75,747,746	Q2575K	probably damaging	Het
Aldh3a2	A	T	11: 61,253,715	I339K	probably damaging	Het
Alox15	G	T	11: 70,345,624	Y483*	probably null	Het
Ampd1	A	T	3: 103,099,597	I713F	probably damaging	Het
Amph	A	T	13: 19,113,116	E344V	possibly damaging	Het
Arid5b	A	G	10: 68,096,977	S1032P	probably damaging	Het
Armc8	C	A	9: 99,505,688	L393F	probably damaging	Het
Bpnt1	A	G	1: 185,345,426		probably null	Het
Cachd1	G	A	4: 100,988,221	R970H	probably damaging	Het
Cd207	T	C	6: 83,675,756	T131A	probably benign	Het
Cd83	G	A	13: 43,797,533	V54I	probably benign	Het
Cfap43	T	C	19: 47,763,676	K1086E	probably benign	Het
Cfap65	A	T	1: 74,902,169	V1837E	probably benign	Het
Clcnka	T	A	4: 141,396,606	H89L	probably benign	Het
Cnga4	T	C	7: 105,404,975	I50T	possibly damaging	Het
Cog5	A	G	12: 31,837,359		probably benign	Het
Col11a2	T	A	17: 34,059,348		probably null	Het
Col28a1	T	G	6: 8,175,291	I186L	possibly damaging	Het
Col4a2	T	A	8: 11,431,252	M808K	probably benign	Het
Copb2	A	G	9: 98,563,475		probably benign	Het
Dbnl	G	A	11: 5,795,441		probably benign	Het
Dbx2	T	C	15: 95,654,612	T51A	possibly damaging	Het
Dcp1a	A	T	14: 30,502,885	M123L	probably damaging	Het
Ddx42	T	A	11: 106,232,833	F217I	probably benign	Het
Dlc1	T	C	8: 36,858,051	T367A	probably benign	Het
Dmgdh	A	T	13: 93,752,355	T834S	probably benign	Het
Dnah8	T	C	17: 30,684,173	S929P	probably damaging	Het
Dnase1l2	C	A	17: 24,441,082	V271L	possibly damaging	Het
Dsc1	T	C	18: 20,096,057	Y392C	probably damaging	Het
Edn1	T	C	13: 42,305,242		probably benign	Het
Eps8l3	T	C	3: 107,884,810	L351P	probably damaging	Het
F12	G	A	13: 55,422,483		probably benign	Het
Fam47e	T	C	5: 92,578,458		probably benign	Het
Fcrl5	C	A	3: 87,442,013	Q32K	probably benign	Het
Fndc1	C	T	17: 7,741,673	V1637I	possibly damaging	Het
Foxg1	G	T	12: 49,384,567		probably benign	Het
Frrs1	A	T	3: 116,902,421	I530F	possibly damaging	Het
Galnt5	A	T	2: 57,999,085	K232N	probably benign	Het
Ggt5	G	A	10: 75,602,648	V68M	probably damaging	Het
Gm11639	G	A	11: 104,720,501	D390N	probably benign	Het
Gm13084	A	C	4: 143,812,585	S113A	possibly damaging	Het
Gm16519	T	C	17: 70,929,106	C17R	probably benign	Het
Gm17535	A	G	9: 3,035,804	Y224C	probably null	Het
Gm884	T	A	11: 103,613,160	K485*	probably null	Het
Gm9631	T	G	11: 121,945,629	D28A	probably damaging	Het
Gpx2	T	C	12: 76,795,313	I21M	probably benign	Het
H2-Q2	T	G	17: 35,345,685	D354E	probably damaging	Het
Icam2	A	T	11: 106,380,891	I71K	probably damaging	Het
Il12a	T	C	3: 68,697,890		probably benign	Het
Insm2	C	G	12: 55,600,440	A323G	probably benign	Het
Itga1	T	C	13: 114,968,299	T1064A	probably benign	Het
Itgad	T	A	7: 128,174,004	V11E	possibly damaging	Het
Kctd15	C	T	7: 34,644,881	S115N	probably damaging	Het
Klra5	A	G	6: 129,903,564	W124R	probably damaging	Het
Kng2	T	A	16: 22,987,736	D571V	probably benign	Het
Kpna6	A	T	4: 129,650,790	F380I	probably benign	Het
Lipo1	A	T	19: 33,784,769	Y109*	probably null	Het
Man2a2	T	C	7: 80,363,197	H540R	possibly damaging	Het
Map2k4	T	C	11: 65,712,275	E188G	probably damaging	Het
Mast4	T	C	13: 102,758,744		probably benign	Het
Mbtd1	A	G	11: 93,905,212	D25G	probably damaging	Het
Med13	T	A	11: 86,331,089	Q238L	possibly damaging	Het
Mmachc	A	G	4: 116,703,654	Y215H	probably damaging	Het
Mtor	T	A	4: 148,484,354	Y1110*	probably null	Het
Nek2	A	G	1: 191,822,219	N57D	probably damaging	Het
Nek7	ACCCC	ACCC	1: 138,515,693		probably null	Het
Neo1	G	T	9: 58,931,034	T489K	probably damaging	Het
Neu1	T	A	17: 34,934,760	Y387N	probably damaging	Het
Nfasc	A	T	1: 132,608,438	C586*	probably null	Het
Nle1	G	A	11: 82,904,845	L259F	probably damaging	Het
Nrde2	G	A	12: 100,143,846	Q309*	probably null	Het
Nufip2	C	T	11: 77,686,453	H76Y	probably benign	Het
Olfr1330	A	C	4: 118,893,490	T136P	probably damaging	Het
Olfr1383	A	T	11: 49,524,578	N285I	probably damaging	Het
Olfr466	A	T	13: 65,153,063	I280F	probably damaging	Het
Olfr584	T	C	7: 103,086,151	F206S	probably damaging	Het
Olfr670	A	T	7: 104,959,811	I307N	probably benign	Het
Olfr731	A	T	14: 50,238,639	I82N	probably damaging	Het
Pcdhb5	A	G	18: 37,321,622	T352A	probably benign	Het
Pcdhb7	A	T	18: 37,343,389	D526V	probably damaging	Het
Phkg1	A	T	5: 129,864,553		probably null	Het
Plg	C	T	17: 12,418,736	T744M	probably damaging	Het
Plxnd1	A	C	6: 115,958,699		probably benign	Het
Poglut1	A	T	16: 38,529,475	I312N	probably damaging	Het
Ppp1r16a	C	T	15: 76,690,799		probably benign	Het
Ppt1	A	G	4: 122,844,099	M77V	probably benign	Het
Pramel5	G	T	4: 144,271,620	T351N	probably damaging	Het
Psmb4	G	A	3: 94,884,964	R216C	probably benign	Het
Ptprd	T	C	4: 76,084,403	T699A	probably damaging	Het
Retreg3	A	T	11: 101,098,629		probably benign	Het
Scaper	G	A	9: 55,758,056	A389V	probably damaging	Het
Serinc5	G	A	13: 92,688,737	D225N	possibly damaging	Het
Slco1a1	T	G	6: 141,925,754		probably benign	Het
Snapc1	C	T	12: 73,975,032	R81C	probably damaging	Het
Sod3	A	T	5: 52,368,079	D40V	probably benign	Het
Spon1	A	T	7: 114,039,821	T761S	probably benign	Het
Syde2	A	G	3: 146,014,249		probably null	Het
Synm	T	A	7: 67,759,168	D154V	probably benign	Het
Synpo2	T	C	3: 123,114,449	E406G	probably damaging	Het
Tcea3	T	A	4: 136,248,071	L8*	probably null	Het
Tec	G	A	5: 72,823,497	L33F	probably damaging	Het
Tex15	T	A	8: 33,582,326	S2634T	possibly damaging	Het
Tg	T	A	15: 66,729,626	Y162N	probably damaging	Het
Tmem8b	G	A	4: 43,690,123	V853I	probably benign	Het
Togaram1	A	G	12: 65,021,466	K1748E	probably damaging	Het
Ttn	T	C	2: 76,898,478		probably benign	Het
Usp36	C	T	11: 118,273,021	D234N	probably damaging	Het
Usp40	G	A	1: 87,978,522	P664S	probably benign	Het
Vmn1r54	T	A	6: 90,269,653	L183H	probably benign	Het
Vmn1r58	T	G	7: 5,410,677	I185L	probably benign	Het
Wnt8a	A	T	18: 34,547,565	R328W	probably benign	Het
Yars	A	G	4: 129,213,939		probably benign	Het
Zbtb49	A	C	5: 38,200,674	M745R	probably damaging	Het
Zeb1	T	G	18: 5,759,027	F162V	probably damaging	Het
Zfp369	A	T	13: 65,297,548	H835L	probably damaging	Het
Zic5	A	G	14: 122,463,939	V460A	unknown	Het
Zp3	A	G	5: 135,984,356	N181D	possibly damaging	Het

Other mutations in Sorcs3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Sorcs3	APN	19	48683658	critical splice donor site	probably null
IGL00233:Sorcs3	APN	19	48748319	missense	probably benign	0.12
IGL00482:Sorcs3	APN	19	48603864	missense	probably benign	0.00
IGL00976:Sorcs3	APN	19	48767103	missense	probably damaging	1.00
IGL01367:Sorcs3	APN	19	48796375	missense	probably damaging	1.00
IGL01390:Sorcs3	APN	19	48790131	missense	probably damaging	1.00
IGL01548:Sorcs3	APN	19	48794168	missense	possibly damaging	0.87
IGL02162:Sorcs3	APN	19	48535531	missense	probably damaging	0.98
IGL02165:Sorcs3	APN	19	48654072	missense	probably benign	0.03
IGL02404:Sorcs3	APN	19	48704370	splice site	probably benign
IGL02830:Sorcs3	APN	19	48723002	splice site	probably null
IGL02943:Sorcs3	APN	19	48759938	missense	probably benign	0.00
R0371:Sorcs3	UTSW	19	48603894	missense	probably benign	0.00
R0456:Sorcs3	UTSW	19	48654044	missense	possibly damaging	0.94
R0466:Sorcs3	UTSW	19	48748319	missense	probably benign	0.12
R0470:Sorcs3	UTSW	19	48797517	critical splice donor site	probably null
R0536:Sorcs3	UTSW	19	48802698	nonsense	probably null
R0709:Sorcs3	UTSW	19	48487406	missense	probably benign
R0792:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R0831:Sorcs3	UTSW	19	48693994	missense	probably damaging	1.00
R0836:Sorcs3	UTSW	19	48487394	missense	probably benign
R1253:Sorcs3	UTSW	19	48206736	missense	possibly damaging	0.67
R1390:Sorcs3	UTSW	19	48694001	critical splice donor site	probably null
R1522:Sorcs3	UTSW	19	48706009	missense	possibly damaging	0.84
R1570:Sorcs3	UTSW	19	48764181	missense	probably damaging	1.00
R1637:Sorcs3	UTSW	19	48748359	critical splice donor site	probably null
R1766:Sorcs3	UTSW	19	48603875	missense	possibly damaging	0.87
R1894:Sorcs3	UTSW	19	48794274	missense	probably benign	0.23
R2426:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R3789:Sorcs3	UTSW	19	48398711	missense	possibly damaging	0.46
R3818:Sorcs3	UTSW	19	48603904	missense	probably benign	0.00
R3824:Sorcs3	UTSW	19	48722956	missense	probably damaging	1.00
R3934:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R3936:Sorcs3	UTSW	19	48713504	missense	probably damaging	1.00
R4190:Sorcs3	UTSW	19	48749373	missense	possibly damaging	0.69
R4604:Sorcs3	UTSW	19	48693914	missense	probably benign	0.35
R4644:Sorcs3	UTSW	19	48683597	missense	probably damaging	1.00
R4774:Sorcs3	UTSW	19	48794163	missense	probably benign	0.23
R4801:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4802:Sorcs3	UTSW	19	48398744	missense	possibly damaging	0.46
R4945:Sorcs3	UTSW	19	48764148	missense	possibly damaging	0.50
R5049:Sorcs3	UTSW	19	48759951	missense	possibly damaging	0.93
R5175:Sorcs3	UTSW	19	48759845	critical splice acceptor site	probably null
R5342:Sorcs3	UTSW	19	48796472	splice site	probably null
R5848:Sorcs3	UTSW	19	48788511	missense	probably damaging	1.00
R5959:Sorcs3	UTSW	19	48749396	missense	probably damaging	1.00
R5977:Sorcs3	UTSW	19	48796450	missense	probably damaging	1.00
R6155:Sorcs3	UTSW	19	48398697	missense	possibly damaging	0.94
R6222:Sorcs3	UTSW	19	48759857	missense	possibly damaging	0.57
R6268:Sorcs3	UTSW	19	48790166	missense	probably damaging	1.00
R6416:Sorcs3	UTSW	19	48802759	missense	probably damaging	1.00
R6425:Sorcs3	UTSW	19	48764307	critical splice donor site	probably null
R6623:Sorcs3	UTSW	19	48788505	missense	probably benign	0.00
R6767:Sorcs3	UTSW	19	48713571	missense	probably damaging	0.99
R6888:Sorcs3	UTSW	19	48693824	missense	possibly damaging	0.83
R6955:Sorcs3	UTSW	19	48749343	missense	possibly damaging	0.82
R7106:Sorcs3	UTSW	19	48705963	missense	probably damaging	1.00
R7379:Sorcs3	UTSW	19	48772266	missense	possibly damaging	0.69
R7953:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8043:Sorcs3	UTSW	19	48764295	missense	possibly damaging	0.84
R8242:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8343:Sorcs3	UTSW	19	48704369	splice site	probably null
R8433:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8435:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8436:Sorcs3	UTSW	19	48206474	missense	possibly damaging	0.53
R8940:Sorcs3	UTSW	19	48796469	critical splice donor site	probably null
R8956:Sorcs3	UTSW	19	48749371	nonsense	probably null
R9051:Sorcs3	UTSW	19	48206370	missense	probably benign
R9119:Sorcs3	UTSW	19	48653994	missense	possibly damaging	0.92
R9166:Sorcs3	UTSW	19	48796372	missense	probably benign	0.01
R9328:Sorcs3	UTSW	19	48797511	missense	probably damaging	1.00
R9489:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R9605:Sorcs3	UTSW	19	48722925	missense	probably damaging	1.00
R9757:Sorcs3	UTSW	19	48722924	missense	probably damaging	1.00
X0018:Sorcs3	UTSW	19	48772289	missense	probably damaging	1.00
Z1176:Sorcs3	UTSW	19	48645804	missense	probably damaging	1.00
Z1177:Sorcs3	UTSW	19	48704300	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTTTGGAATCACCCTCTGGACCTG -3'
(R):5'- TTCCTTTGGCACCATCTGCGAG -3'

Sequencing Primer
(F):5'- TCTGGACCTGGGAGCAAG -3'
(R):5'- ATCTGCGAGAGCAGTAGCC -3'

Posted On

2013-07-11