Incidental Mutation 'R7375:Arhgap5'
ID572346
Institutional Source Beutler Lab
Gene Symbol Arhgap5
Ensembl Gene ENSMUSG00000035133
Gene NameRho GTPase activating protein 5
Synonymsp190B, p190-B
MMRRC Submission
Accession Numbers

Genbank: NM_009706; MGI: 1332637

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7375 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location52503972-52571975 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 52516582 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 112 (L112*)
Ref Sequence ENSEMBL: ENSMUSP00000106353 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110725] [ENSMUST00000217820] [ENSMUST00000219443]
Predicted Effect probably null
Transcript: ENSMUST00000110725
AA Change: L112*
SMART Domains Protein: ENSMUSP00000106353
Gene: ENSMUSG00000035133
AA Change: L112*

DomainStartEndE-ValueType
Pfam:Ras 142 248 5.3e-7 PFAM
FF 269 325 6.03e-12 SMART
FF 367 420 4.61e-8 SMART
FF 427 482 2.22e-10 SMART
FF 483 537 3.89e-6 SMART
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1224 1247 N/A INTRINSIC
RhoGAP 1273 1447 1.03e-73 SMART
low complexity region 1479 1496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000217820
Predicted Effect probably null
Transcript: ENSMUST00000219443
AA Change: L112*
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (59/59)
MGI Phenotype Strain: 2179998
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPase activating protein 5 negatively regulates RHO GTPases, a family which may mediate cytoskeleton changes by stimulating the hydrolysis of bound GTP. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes die at birth, are 30% smaller, do not inflate their lungs, and show a small thymus, abnormal adipocyte differentiation and brain defects in the corpus callosum, anterior commissure and lateral ventricles. Mutant MEFs show impaired adipogenesis but undergo myogenesis in response to IGF-1. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A G 5: 8,918,671 I337V probably benign Het
Abl2 A G 1: 156,622,614 D117G probably damaging Het
Brinp3 C G 1: 146,902,010 L732V possibly damaging Het
Cmya5 T G 13: 93,091,661 K2306N probably damaging Het
Col16a1 A C 4: 130,065,501 K680T unknown Het
Col28a1 T A 6: 7,998,499 T1137S possibly damaging Het
Crnn A T 3: 93,149,145 T413S possibly damaging Het
Csf1 A G 3: 107,748,179 L512P possibly damaging Het
Dlx3 C A 11: 95,120,635 A105D possibly damaging Het
Dnah3 T G 7: 119,951,677 T161P probably damaging Het
Dnah7b A G 1: 46,303,634 D3435G probably damaging Het
Dpp10 A G 1: 123,367,795 I541T probably benign Het
Efcc1 T C 6: 87,751,856 V431A possibly damaging Het
Enpp5 T C 17: 44,080,977 I99T probably benign Het
Fam192a G A 8: 94,583,008 L119F probably benign Het
Gm11232 C T 4: 71,757,346 W59* probably null Het
Gm17660 G T 5: 104,071,257 probably null Het
Gm8251 A T 1: 44,060,534 I468N possibly damaging Het
Gxylt2 A T 6: 100,750,422 T166S probably benign Het
Herc6 A T 6: 57,651,806 probably null Het
Itga2 T C 13: 114,869,217 I476V probably benign Het
Kcnq5 T C 1: 21,469,486 T403A possibly damaging Het
Klhl42 A G 6: 147,092,040 K170R probably benign Het
Klk13 T C 7: 43,721,158 probably null Het
Krt32 G T 11: 100,081,224 R433S probably benign Het
Lrp1 G T 10: 127,539,348 T4461N probably damaging Het
Maats1 T A 16: 38,335,618 H81L probably damaging Het
Mapk10 A T 5: 102,976,390 M256K probably null Het
Mogat2 T C 7: 99,223,698 K93R probably damaging Het
Myh1 G T 11: 67,210,428 V677L probably damaging Het
Naip5 T C 13: 100,219,696 Q1137R probably benign Het
Naip5 G T 13: 100,219,697 Q1137K not run Het
Olfr1242 C T 2: 89,493,692 G207R possibly damaging Het
Oog4 G A 4: 143,438,974 T201M possibly damaging Het
Pik3c2a T C 7: 116,376,386 T649A probably damaging Het
Plec T A 15: 76,177,355 H2794L possibly damaging Het
Pros1 T A 16: 62,924,550 N509K probably damaging Het
Psme4 T A 11: 30,772,700 probably null Het
Ptprf A G 4: 118,212,814 V1457A probably benign Het
Rad50 A G 11: 53,652,228 probably null Het
Rfx5 C T 3: 94,958,742 P451S unknown Het
Sdk1 G T 5: 141,998,843 V728L probably benign Het
Sfxn4 T C 19: 60,858,674 D57G probably benign Het
Slc10a4 A G 5: 73,012,307 D425G probably benign Het
Slc17a5 C T 9: 78,587,892 A26T probably benign Het
Slc22a26 A T 19: 7,783,144 probably null Het
Slc22a30 A G 19: 8,404,691 L72P probably damaging Het
Slco6c1 T C 1: 97,081,421 T447A possibly damaging Het
Slco6d1 A G 1: 98,421,447 N81S probably damaging Het
Stard9 T C 2: 120,665,002 probably null Het
Tecpr1 T C 5: 144,208,599 E610G possibly damaging Het
Tmem81 G T 1: 132,507,563 V36L possibly damaging Het
Trabd2b G T 4: 114,609,997 K474N probably benign Het
Tspan33 T C 6: 29,713,520 F149L probably benign Het
Ttn A G 2: 76,776,339 Y18076H probably damaging Het
Utrn G A 10: 12,641,020 R2277C probably damaging Het
Vmn2r101 T A 17: 19,611,390 D549E probably damaging Het
Vmn2r107 T A 17: 20,355,876 I156K probably benign Het
Wwc2 T G 8: 47,863,920 S713R unknown Het
Xndc1 C A 7: 102,081,480 probably null Het
Zfp810 A G 9: 22,290,537 probably null Het
Other mutations in Arhgap5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Arhgap5 APN 12 52517281 missense probably damaging 0.98
IGL00823:Arhgap5 APN 12 52518742 missense possibly damaging 0.84
IGL01161:Arhgap5 APN 12 52516860 missense probably damaging 1.00
IGL01360:Arhgap5 APN 12 52518240 missense probably damaging 1.00
IGL01910:Arhgap5 APN 12 52516861 missense probably benign 0.33
IGL02417:Arhgap5 APN 12 52518353 missense probably damaging 0.99
IGL02448:Arhgap5 APN 12 52562340 missense probably damaging 0.97
IGL02813:Arhgap5 APN 12 52516965 missense probably benign 0.20
IGL03398:Arhgap5 APN 12 52517311 missense probably damaging 0.99
Decline UTSW 12 52516582 nonsense probably null
Pass UTSW 12 52516507 missense possibly damaging 0.82
3-1:Arhgap5 UTSW 12 52518882 missense possibly damaging 0.54
R0039:Arhgap5 UTSW 12 52518735 nonsense probably null
R0088:Arhgap5 UTSW 12 52516548 missense probably damaging 1.00
R0104:Arhgap5 UTSW 12 52516717 missense probably damaging 1.00
R0111:Arhgap5 UTSW 12 52559960 splice site probably benign
R0356:Arhgap5 UTSW 12 52516308 missense probably damaging 1.00
R0616:Arhgap5 UTSW 12 52517065 missense possibly damaging 0.79
R0707:Arhgap5 UTSW 12 52518168 missense probably damaging 1.00
R0718:Arhgap5 UTSW 12 52516507 missense possibly damaging 0.82
R0849:Arhgap5 UTSW 12 52519623 missense probably benign 0.01
R0975:Arhgap5 UTSW 12 52517144 missense possibly damaging 0.61
R1326:Arhgap5 UTSW 12 52518370 missense possibly damaging 0.80
R1421:Arhgap5 UTSW 12 52516848 missense probably damaging 1.00
R1422:Arhgap5 UTSW 12 52519514 missense probably damaging 1.00
R1625:Arhgap5 UTSW 12 52517376 missense probably benign
R1711:Arhgap5 UTSW 12 52519345 missense probably damaging 1.00
R1970:Arhgap5 UTSW 12 52542593 missense probably damaging 1.00
R2004:Arhgap5 UTSW 12 52518034 missense probably benign 0.05
R2356:Arhgap5 UTSW 12 52519147 missense probably benign 0.00
R3792:Arhgap5 UTSW 12 52519888 missense probably benign 0.21
R3808:Arhgap5 UTSW 12 52567187 missense possibly damaging 0.72
R4458:Arhgap5 UTSW 12 52517957 missense probably benign
R4703:Arhgap5 UTSW 12 52517583 missense probably damaging 0.99
R4736:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4737:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4740:Arhgap5 UTSW 12 52519077 missense probably benign 0.00
R4768:Arhgap5 UTSW 12 52557492 missense probably damaging 1.00
R4806:Arhgap5 UTSW 12 52518703 missense probably damaging 0.99
R4817:Arhgap5 UTSW 12 52519209 missense possibly damaging 0.71
R5586:Arhgap5 UTSW 12 52519912 missense possibly damaging 0.95
R5681:Arhgap5 UTSW 12 52519779 missense probably benign 0.21
R5683:Arhgap5 UTSW 12 52519586 missense probably benign
R5911:Arhgap5 UTSW 12 52518742 missense possibly damaging 0.84
R6448:Arhgap5 UTSW 12 52517663 missense probably benign 0.11
R6887:Arhgap5 UTSW 12 52519144 missense probably benign
R6988:Arhgap5 UTSW 12 52518125 missense possibly damaging 0.94
R7009:Arhgap5 UTSW 12 52519639 missense probably benign 0.03
R7013:Arhgap5 UTSW 12 52518326 missense probably benign 0.05
R7239:Arhgap5 UTSW 12 52517376 missense probably benign
R7310:Arhgap5 UTSW 12 52542487 critical splice acceptor site probably null
R7339:Arhgap5 UTSW 12 52517698 missense possibly damaging 0.64
R7421:Arhgap5 UTSW 12 52518000 missense probably benign 0.42
R7442:Arhgap5 UTSW 12 52516956 missense probably benign 0.25
R7842:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
R7925:Arhgap5 UTSW 12 52518697 missense possibly damaging 0.78
X0018:Arhgap5 UTSW 12 52518397 missense probably damaging 1.00
Z1176:Arhgap5 UTSW 12 52518463 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGCTTAGCACCATTGACTTTGG -3'
(R):5'- GTTGCTGCTATTATCACAGGC -3'

Sequencing Primer
(F):5'- ACCATTGACTTTGGAGGCC -3'
(R):5'- AGCTGGACAAAAAGGTTATTCAC -3'
Posted On2019-09-13