Mutagenetix > Incidental Mutation

Incidental Mutation 'R7376:Clspn'

572374

Institutional Source

Beutler Lab

Gene Symbol

Clspn

Ensembl Gene

ENSMUSG00000042489

Gene Name

claspin

Synonyms

C85083, E130314M08Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7376 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

126556935-126593903 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 126590637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 1196 (K1196R)

Ref Sequence

ENSEMBL: ENSMUSP00000045344 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048391]

AlphaFold

Q80YR7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000048391
AA Change: K1196R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: K1196R

Domain	Start	End	E-Value	Type
low complexity region	64	75	N/A	INTRINSIC
coiled coil region	159	187	N/A	INTRINSIC
low complexity region	214	230	N/A	INTRINSIC
low complexity region	232	245	N/A	INTRINSIC
low complexity region	477	490	N/A	INTRINSIC
coiled coil region	599	626	N/A	INTRINSIC
low complexity region	632	658	N/A	INTRINSIC
low complexity region	664	681	N/A	INTRINSIC
low complexity region	732	753	N/A	INTRINSIC
low complexity region	793	812	N/A	INTRINSIC
low complexity region	968	975	N/A	INTRINSIC
coiled coil region	1001	1036	N/A	INTRINSIC
low complexity region	1045	1064	N/A	INTRINSIC

Meta Mutation Damage Score

0.0620

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,291,118	I994V	probably benign	Het
Acan	T	G	7: 79,088,307		probably null	Het
Adamts12	G	A	15: 11,277,339	V680I	possibly damaging	Het
Adgrg7	T	C	16: 56,724,979	I712V	probably damaging	Het
Adgrl3	A	G	5: 81,794,750	H1477R	probably damaging	Het
Adgrv1	T	A	13: 81,518,126	D1937V	probably damaging	Het
Alms1	T	C	6: 85,622,106	S1305P	probably benign	Het
Banp	T	A	8: 121,974,497	M39K	probably damaging	Het
Bbs10	A	G	10: 111,299,250	T75A	probably benign	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Brinp2	C	T	1: 158,251,368	C295Y	probably damaging	Het
Card11	C	T	5: 140,898,238	V429I	probably benign	Het
Cdca3	G	A	6: 124,832,575	R184H	probably benign	Het
Cep104	A	G	4: 153,983,052		probably null	Het
Cntnap5b	A	G	1: 99,967,269	T89A	possibly damaging	Het
Cpne9	A	T	6: 113,290,013	I136L	probably damaging	Het
Crat	T	A	2: 30,406,465	I330F	probably damaging	Het
Ctbp2	G	T	7: 133,013,968	Q413K	possibly damaging	Het
D630045J12Rik	T	C	6: 38,174,303	E1220G	probably damaging	Het
Dap	A	G	15: 31,235,839	D41G	probably damaging	Het
Dnah14	A	G	1: 181,763,402	I3287V	probably benign	Het
Dsp	A	G	13: 38,172,843	H233R	probably damaging	Het
Dst	T	C	1: 34,192,689	I3121T	probably benign	Het
Espnl	T	G	1: 91,322,314	L61R	probably damaging	Het
Evc2	T	C	5: 37,370,639	S331P	possibly damaging	Het
Gars	A	G	6: 55,073,359	E535G	probably benign	Het
Hfm1	A	G	5: 106,895,218	I650T	possibly damaging	Het
Iyd	T	A	10: 3,545,690	I116N	probably damaging	Het
Kif16b	A	G	2: 142,711,872	L1002S	probably damaging	Het
Kif1bp	C	T	10: 62,559,064	V600I	possibly damaging	Het
Lgi1	G	A	19: 38,284,020	G113D	probably damaging	Het
Lgi2	G	A	5: 52,538,262	R452C	probably damaging	Het
Man2b2	T	G	5: 36,813,378	N764T	probably damaging	Het
Mrps18b	A	G	17: 35,910,695	I246T	probably benign	Het
Muc5b	A	G	7: 141,872,550	T4795A	possibly damaging	Het
Mybl2	G	A	2: 163,082,593	G627D	possibly damaging	Het
Ndufb8	C	T	19: 44,555,355	R16K	probably benign	Het
Olfr181	A	T	16: 58,925,758	V271E	possibly damaging	Het
P4htm	C	T	9: 108,580,792	V335M	probably damaging	Het
Pbx3	A	G	2: 34,204,877	I249T	probably damaging	Het
Plod3	G	T	5: 136,990,481	V360L	probably benign	Het
Podxl2	C	T	6: 88,849,650	D161N	probably benign	Het
Polr1b	G	T	2: 129,119,073	V651L	probably benign	Het
Prr14	T	C	7: 127,476,577	S586P	probably benign	Het
Pum3	C	T	19: 27,394,328	G575D	probably benign	Het
Rnf157	C	A	11: 116,360,366	A111S	probably benign	Het
Robo3	A	G	9: 37,432,916	L29P	probably damaging	Het
Smarca5	T	C	8: 80,726,051	N342S	probably damaging	Het
Specc1	T	A	11: 62,118,252	I198K	probably benign	Het
Tmem177	A	T	1: 119,910,014	*312R	probably null	Het
Tom1l2	A	T	11: 60,261,200	M172K	probably benign	Het
Tsc22d4	T	C	5: 137,758,152	V3A	unknown	Het
Uhrf1bp1l	G	A	10: 89,809,656	G1197D	probably damaging	Het
Vmn1r128	G	T	7: 21,349,743	G124V	probably damaging	Het
Vmn1r15	T	C	6: 57,258,357	I70T	probably benign	Het
Vmn2r60	A	G	7: 42,195,207	T665A	probably damaging	Het
Vmn2r83	T	C	10: 79,478,956	F346S	probably benign	Het
Wdr7	T	A	18: 63,777,620	D694E	probably damaging	Het

Other mutations in Clspn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Clspn	APN	4	126573178	missense	probably damaging	1.00
IGL02160:Clspn	APN	4	126581510	missense	probably benign	0.21
IGL02231:Clspn	APN	4	126559228	missense	probably damaging	0.98
IGL02281:Clspn	APN	4	126565770	missense	possibly damaging	0.90
IGL02368:Clspn	APN	4	126566107	missense	probably benign
IGL03149:Clspn	APN	4	126576502	splice site	probably benign
Durch	UTSW	4	126580962	missense	probably damaging	0.99
R0012:Clspn	UTSW	4	126564929	unclassified	probably benign
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0035:Clspn	UTSW	4	126565003	splice site	probably null
R0207:Clspn	UTSW	4	126590598	missense	possibly damaging	0.82
R0270:Clspn	UTSW	4	126573236	missense	probably damaging	1.00
R0825:Clspn	UTSW	4	126573130	splice site	probably benign
R1082:Clspn	UTSW	4	126577779	missense	possibly damaging	0.95
R1349:Clspn	UTSW	4	126563977	missense	probably benign
R1568:Clspn	UTSW	4	126581517	missense	probably benign	0.01
R1649:Clspn	UTSW	4	126566435	unclassified	probably benign
R1663:Clspn	UTSW	4	126565975	missense	probably benign	0.00
R2497:Clspn	UTSW	4	126572347	missense	possibly damaging	0.79
R3107:Clspn	UTSW	4	126591659	missense	probably benign	0.06
R3951:Clspn	UTSW	4	126576379	missense	probably damaging	1.00
R3953:Clspn	UTSW	4	126566437	frame shift	probably null
R3954:Clspn	UTSW	4	126566437	frame shift	probably null
R3956:Clspn	UTSW	4	126566437	frame shift	probably null
R4599:Clspn	UTSW	4	126581460	missense	probably benign	0.14
R4717:Clspn	UTSW	4	126560056	missense	probably damaging	1.00
R4853:Clspn	UTSW	4	126566555	missense	probably damaging	0.99
R4854:Clspn	UTSW	4	126575950	missense	probably benign
R4979:Clspn	UTSW	4	126578386	missense	probably damaging	1.00
R5363:Clspn	UTSW	4	126561786	missense	possibly damaging	0.58
R5531:Clspn	UTSW	4	126577773	missense	probably benign
R5614:Clspn	UTSW	4	126580962	missense	probably damaging	0.99
R5706:Clspn	UTSW	4	126578418	missense	probably damaging	1.00
R5806:Clspn	UTSW	4	126586106	missense	probably damaging	1.00
R6106:Clspn	UTSW	4	126590641	missense	probably benign	0.00
R6178:Clspn	UTSW	4	126577736	splice site	probably null
R6223:Clspn	UTSW	4	126586168	missense	probably damaging	0.99
R6326:Clspn	UTSW	4	126565739	missense	probably damaging	1.00
R6398:Clspn	UTSW	4	126563947	missense	probably damaging	1.00
R6714:Clspn	UTSW	4	126565768	missense	probably damaging	1.00
R7003:Clspn	UTSW	4	126592720	missense	possibly damaging	0.63
R7034:Clspn	UTSW	4	126580982	missense	possibly damaging	0.87
R7358:Clspn	UTSW	4	126566200	missense	probably benign	0.02
R7675:Clspn	UTSW	4	126566320	missense	probably benign	0.00
R8320:Clspn	UTSW	4	126563950	missense	possibly damaging	0.73
R8517:Clspn	UTSW	4	126566219	missense	probably benign	0.00
R8547:Clspn	UTSW	4	126561816	missense	probably damaging	1.00
R9106:Clspn	UTSW	4	126577450	intron	probably benign
R9223:Clspn	UTSW	4	126590618	missense	possibly damaging	0.60
R9361:Clspn	UTSW	4	126585861	missense	probably damaging	0.99
R9527:Clspn	UTSW	4	126559999	nonsense	probably null
R9717:Clspn	UTSW	4	126564963	missense	possibly damaging	0.90
T0975:Clspn	UTSW	4	126566437	unclassified	probably benign
X0014:Clspn	UTSW	4	126575943	missense	probably damaging	1.00
Z1177:Clspn	UTSW	4	126566177	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCTGAAGGTAATGTAATGTTGCATG -3'
(R):5'- AGCTAAGAGACAACGTCTGCC -3'

Sequencing Primer
(F):5'- CTCTCCAAGTGCTGGGATCATAG -3'
(R):5'- GAGACAACGTCTGCCTCTCC -3'

Posted On

2019-09-13