Incidental Mutation 'R7376:Clspn'
ID 572374
Institutional Source Beutler Lab
Gene Symbol Clspn
Ensembl Gene ENSMUSG00000042489
Gene Name claspin
Synonyms C85083, E130314M08Rik
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7376 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 126556935-126593903 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 126590637 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 1196 (K1196R)
Ref Sequence ENSEMBL: ENSMUSP00000045344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048391]
AlphaFold Q80YR7
Predicted Effect possibly damaging
Transcript: ENSMUST00000048391
AA Change: K1196R

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000045344
Gene: ENSMUSG00000042489
AA Change: K1196R

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
coiled coil region 159 187 N/A INTRINSIC
low complexity region 214 230 N/A INTRINSIC
low complexity region 232 245 N/A INTRINSIC
low complexity region 477 490 N/A INTRINSIC
coiled coil region 599 626 N/A INTRINSIC
low complexity region 632 658 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 732 753 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 968 975 N/A INTRINSIC
coiled coil region 1001 1036 N/A INTRINSIC
low complexity region 1045 1064 N/A INTRINSIC
Meta Mutation Damage Score 0.0620 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (60/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is an essential upstream regulator of checkpoint kinase 1 and triggers a checkpoint arrest of the cell cycle in response to replicative stress or DNA damage. The protein is also required for efficient DNA replication during a normal S phase. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Acan T G 7: 79,088,307 probably null Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Brinp2 C T 1: 158,251,368 C295Y probably damaging Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Cep104 A G 4: 153,983,052 probably null Het
Cntnap5b A G 1: 99,967,269 T89A possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi1 G A 19: 38,284,020 G113D probably damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
Olfr181 A T 16: 58,925,758 V271E possibly damaging Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Other mutations in Clspn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Clspn APN 4 126573178 missense probably damaging 1.00
IGL02160:Clspn APN 4 126581510 missense probably benign 0.21
IGL02231:Clspn APN 4 126559228 missense probably damaging 0.98
IGL02281:Clspn APN 4 126565770 missense possibly damaging 0.90
IGL02368:Clspn APN 4 126566107 missense probably benign
IGL03149:Clspn APN 4 126576502 splice site probably benign
Durch UTSW 4 126580962 missense probably damaging 0.99
R0012:Clspn UTSW 4 126564929 unclassified probably benign
R0035:Clspn UTSW 4 126565003 splice site probably null
R0035:Clspn UTSW 4 126565003 splice site probably null
R0207:Clspn UTSW 4 126590598 missense possibly damaging 0.82
R0270:Clspn UTSW 4 126573236 missense probably damaging 1.00
R0825:Clspn UTSW 4 126573130 splice site probably benign
R1082:Clspn UTSW 4 126577779 missense possibly damaging 0.95
R1349:Clspn UTSW 4 126563977 missense probably benign
R1568:Clspn UTSW 4 126581517 missense probably benign 0.01
R1649:Clspn UTSW 4 126566435 unclassified probably benign
R1663:Clspn UTSW 4 126565975 missense probably benign 0.00
R2497:Clspn UTSW 4 126572347 missense possibly damaging 0.79
R3107:Clspn UTSW 4 126591659 missense probably benign 0.06
R3951:Clspn UTSW 4 126576379 missense probably damaging 1.00
R3953:Clspn UTSW 4 126566437 frame shift probably null
R3954:Clspn UTSW 4 126566437 frame shift probably null
R3956:Clspn UTSW 4 126566437 frame shift probably null
R4599:Clspn UTSW 4 126581460 missense probably benign 0.14
R4717:Clspn UTSW 4 126560056 missense probably damaging 1.00
R4853:Clspn UTSW 4 126566555 missense probably damaging 0.99
R4854:Clspn UTSW 4 126575950 missense probably benign
R4979:Clspn UTSW 4 126578386 missense probably damaging 1.00
R5363:Clspn UTSW 4 126561786 missense possibly damaging 0.58
R5531:Clspn UTSW 4 126577773 missense probably benign
R5614:Clspn UTSW 4 126580962 missense probably damaging 0.99
R5706:Clspn UTSW 4 126578418 missense probably damaging 1.00
R5806:Clspn UTSW 4 126586106 missense probably damaging 1.00
R6106:Clspn UTSW 4 126590641 missense probably benign 0.00
R6178:Clspn UTSW 4 126577736 splice site probably null
R6223:Clspn UTSW 4 126586168 missense probably damaging 0.99
R6326:Clspn UTSW 4 126565739 missense probably damaging 1.00
R6398:Clspn UTSW 4 126563947 missense probably damaging 1.00
R6714:Clspn UTSW 4 126565768 missense probably damaging 1.00
R7003:Clspn UTSW 4 126592720 missense possibly damaging 0.63
R7034:Clspn UTSW 4 126580982 missense possibly damaging 0.87
R7358:Clspn UTSW 4 126566200 missense probably benign 0.02
R7675:Clspn UTSW 4 126566320 missense probably benign 0.00
R8320:Clspn UTSW 4 126563950 missense possibly damaging 0.73
R8517:Clspn UTSW 4 126566219 missense probably benign 0.00
R8547:Clspn UTSW 4 126561816 missense probably damaging 1.00
R9106:Clspn UTSW 4 126577450 intron probably benign
R9223:Clspn UTSW 4 126590618 missense possibly damaging 0.60
R9361:Clspn UTSW 4 126585861 missense probably damaging 0.99
R9527:Clspn UTSW 4 126559999 nonsense probably null
R9717:Clspn UTSW 4 126564963 missense possibly damaging 0.90
T0975:Clspn UTSW 4 126566437 unclassified probably benign
X0014:Clspn UTSW 4 126575943 missense probably damaging 1.00
Z1177:Clspn UTSW 4 126566177 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTGAAGGTAATGTAATGTTGCATG -3'
(R):5'- AGCTAAGAGACAACGTCTGCC -3'

Sequencing Primer
(F):5'- CTCTCCAAGTGCTGGGATCATAG -3'
(R):5'- GAGACAACGTCTGCCTCTCC -3'
Posted On 2019-09-13