Mutagenetix > Incidental Mutations

Incidental Mutation 'R7376:Hfm1'

572379

Institutional Source

Beutler Lab

Gene Symbol

Hfm1

Ensembl Gene

ENSMUSG00000043410

Gene Name

HFM1, ATP-dependent DNA helicase homolog

Synonyms

LOC381663, A330009G12Rik, Mer3, Sec63d1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R7376 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106840192-106926321 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 106895218 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 650 (I650T)

Ref Sequence

ENSEMBL: ENSMUSP00000108310 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112690
AA Change: I650T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: I650T

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117588
AA Change: I650T

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: I650T

Domain	Start	End	E-Value	Type
DEXDc	276	490	3.66e-29	SMART
HELICc	571	657	1.56e-14	SMART
low complexity region	751	764	N/A	INTRINSIC
Sec63	775	1090	5.66e-60	SMART
Blast:Sec63	1130	1188	2e-18	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000148495
AA Change: I37T

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,291,118	I994V	probably benign	Het
Acan	T	G	7: 79,088,307		probably null	Het
Adamts12	G	A	15: 11,277,339	V680I	possibly damaging	Het
Adgrg7	T	C	16: 56,724,979	I712V	probably damaging	Het
Adgrl3	A	G	5: 81,794,750	H1477R	probably damaging	Het
Adgrv1	T	A	13: 81,518,126	D1937V	probably damaging	Het
Alms1	T	C	6: 85,622,106	S1305P	probably benign	Het
Banp	T	A	8: 121,974,497	M39K	probably damaging	Het
Bbs10	A	G	10: 111,299,250	T75A	probably benign	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Brinp2	C	T	1: 158,251,368	C295Y	probably damaging	Het
Card11	C	T	5: 140,898,238	V429I	probably benign	Het
Cdca3	G	A	6: 124,832,575	R184H	probably benign	Het
Cep104	A	G	4: 153,983,052		probably null	Het
Clspn	A	G	4: 126,590,637	K1196R	possibly damaging	Het
Cntnap5b	A	G	1: 99,967,269	T89A	possibly damaging	Het
Cpne9	A	T	6: 113,290,013	I136L	probably damaging	Het
Crat	T	A	2: 30,406,465	I330F	probably damaging	Het
Ctbp2	G	T	7: 133,013,968	Q413K	possibly damaging	Het
D630045J12Rik	T	C	6: 38,174,303	E1220G	probably damaging	Het
Dap	A	G	15: 31,235,839	D41G	probably damaging	Het
Dnah14	A	G	1: 181,763,402	I3287V	probably benign	Het
Dsp	A	G	13: 38,172,843	H233R	probably damaging	Het
Dst	T	C	1: 34,192,689	I3121T	probably benign	Het
Espnl	T	G	1: 91,322,314	L61R	probably damaging	Het
Evc2	T	C	5: 37,370,639	S331P	possibly damaging	Het
Gars	A	G	6: 55,073,359	E535G	probably benign	Het
Iyd	T	A	10: 3,545,690	I116N	probably damaging	Het
Kif16b	A	G	2: 142,711,872	L1002S	probably damaging	Het
Kif1bp	C	T	10: 62,559,064	V600I	possibly damaging	Het
Lgi1	G	A	19: 38,284,020	G113D	probably damaging	Het
Lgi2	G	A	5: 52,538,262	R452C	probably damaging	Het
Man2b2	T	G	5: 36,813,378	N764T	probably damaging	Het
Mrps18b	A	G	17: 35,910,695	I246T	probably benign	Het
Muc5b	A	G	7: 141,872,550	T4795A	possibly damaging	Het
Mybl2	G	A	2: 163,082,593	G627D	possibly damaging	Het
Ndufb8	C	T	19: 44,555,355	R16K	probably benign	Het
Olfr181	A	T	16: 58,925,758	V271E	possibly damaging	Het
P4htm	C	T	9: 108,580,792	V335M	probably damaging	Het
Pbx3	A	G	2: 34,204,877	I249T	probably damaging	Het
Plod3	G	T	5: 136,990,481	V360L	probably benign	Het
Podxl2	C	T	6: 88,849,650	D161N	probably benign	Het
Polr1b	G	T	2: 129,119,073	V651L	probably benign	Het
Prr14	T	C	7: 127,476,577	S586P	probably benign	Het
Pum3	C	T	19: 27,394,328	G575D	probably benign	Het
Rnf157	C	A	11: 116,360,366	A111S	probably benign	Het
Robo3	A	G	9: 37,432,916	L29P	probably damaging	Het
Smarca5	T	C	8: 80,726,051	N342S	probably damaging	Het
Specc1	T	A	11: 62,118,252	I198K	probably benign	Het
Tmem177	A	T	1: 119,910,014	*312R	probably null	Het
Tom1l2	A	T	11: 60,261,200	M172K	probably benign	Het
Tsc22d4	T	C	5: 137,758,152	V3A	unknown	Het
Uhrf1bp1l	G	A	10: 89,809,656	G1197D	probably damaging	Het
Vmn1r128	G	T	7: 21,349,743	G124V	probably damaging	Het
Vmn1r15	T	C	6: 57,258,357	I70T	probably benign	Het
Vmn2r60	A	G	7: 42,195,207	T665A	probably damaging	Het
Vmn2r83	T	C	10: 79,478,956	F346S	probably benign	Het
Wdr7	T	A	18: 63,777,620	D694E	probably damaging	Het

Other mutations in Hfm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Hfm1	APN	5	106902130	missense	possibly damaging	0.70
IGL01295:Hfm1	APN	5	106917606	missense	possibly damaging	0.46
IGL01725:Hfm1	APN	5	106917379	missense	probably benign	0.00
IGL01758:Hfm1	APN	5	106904793	missense	probably damaging	0.99
IGL01911:Hfm1	APN	5	106911544	missense	possibly damaging	0.92
IGL02337:Hfm1	APN	5	106904267	missense	possibly damaging	0.81
IGL02472:Hfm1	APN	5	106873928	splice site	probably benign
IGL02496:Hfm1	APN	5	106901761	missense	probably benign	0.00
IGL02545:Hfm1	APN	5	106895287	missense	probably damaging	1.00
IGL02584:Hfm1	APN	5	106878662	splice site	probably null
IGL02728:Hfm1	APN	5	106878823	missense	probably benign	0.13
IGL02881:Hfm1	APN	5	106874252	missense	probably damaging	1.00
IGL03108:Hfm1	APN	5	106895934	unclassified	probably benign
IGL03351:Hfm1	APN	5	106911575	nonsense	probably null
IGL03353:Hfm1	APN	5	106856929	missense	probably damaging	0.99
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0024:Hfm1	UTSW	5	106856924	missense	probably benign	0.41
R0094:Hfm1	UTSW	5	106917478	missense	probably benign
R0633:Hfm1	UTSW	5	106917601	missense	possibly damaging	0.56
R0644:Hfm1	UTSW	5	106898256	critical splice donor site	probably null
R1078:Hfm1	UTSW	5	106878830	missense	probably damaging	1.00
R1120:Hfm1	UTSW	5	106904218	splice site	probably benign
R1166:Hfm1	UTSW	5	106911411	missense	probably benign	0.00
R1242:Hfm1	UTSW	5	106874901	missense	probably damaging	0.99
R1414:Hfm1	UTSW	5	106872353	missense	probably benign	0.01
R1450:Hfm1	UTSW	5	106918458	missense	probably damaging	0.99
R1529:Hfm1	UTSW	5	106853123	missense	probably benign	0.00
R1622:Hfm1	UTSW	5	106893523	missense	possibly damaging	0.58
R1710:Hfm1	UTSW	5	106880514	missense	probably damaging	1.00
R1710:Hfm1	UTSW	5	106896003	missense	probably damaging	0.96
R1757:Hfm1	UTSW	5	106880360	splice site	probably null
R1856:Hfm1	UTSW	5	106847676	missense	probably benign	0.00
R1984:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R1985:Hfm1	UTSW	5	106898576	missense	probably damaging	0.98
R2040:Hfm1	UTSW	5	106901818	missense	probably damaging	1.00
R2122:Hfm1	UTSW	5	106896255	missense	probably damaging	1.00
R2426:Hfm1	UTSW	5	106847653	splice site	probably null
R2474:Hfm1	UTSW	5	106872416	missense	possibly damaging	0.81
R2926:Hfm1	UTSW	5	106874282	nonsense	probably null
R2944:Hfm1	UTSW	5	106872330	missense	probably damaging	1.00
R3705:Hfm1	UTSW	5	106892839	unclassified	probably benign
R4256:Hfm1	UTSW	5	106904797	missense	possibly damaging	0.83
R4455:Hfm1	UTSW	5	106886508	splice site	probably null
R4538:Hfm1	UTSW	5	106874890	missense	possibly damaging	0.47
R4540:Hfm1	UTSW	5	106874221	nonsense	probably null
R4591:Hfm1	UTSW	5	106847667	missense	probably benign	0.08
R4745:Hfm1	UTSW	5	106901843	missense	possibly damaging	0.87
R4747:Hfm1	UTSW	5	106917523	missense	probably benign
R4765:Hfm1	UTSW	5	106842539	missense	probably benign	0.21
R4821:Hfm1	UTSW	5	106854740	critical splice donor site	probably null
R4842:Hfm1	UTSW	5	106892751	missense	probably damaging	1.00
R4944:Hfm1	UTSW	5	106874213	missense	possibly damaging	0.46
R5093:Hfm1	UTSW	5	106901731	missense	probably damaging	1.00
R5399:Hfm1	UTSW	5	106917562	missense	possibly damaging	0.91
R5414:Hfm1	UTSW	5	106902076	missense	probably damaging	1.00
R5436:Hfm1	UTSW	5	106892772	missense	possibly damaging	0.61
R5459:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5485:Hfm1	UTSW	5	106847662	critical splice donor site	probably null
R5585:Hfm1	UTSW	5	106911439	missense	probably benign	0.05
R5631:Hfm1	UTSW	5	106904763	missense	probably damaging	1.00
R5705:Hfm1	UTSW	5	106911453	missense	probably benign	0.21
R5804:Hfm1	UTSW	5	106878589	splice site	probably null
R5959:Hfm1	UTSW	5	106874917	missense	probably damaging	1.00
R6046:Hfm1	UTSW	5	106898643	splice site	probably null
R6191:Hfm1	UTSW	5	106886553	missense	possibly damaging	0.95
R6345:Hfm1	UTSW	5	106841638	missense	probably benign
R6580:Hfm1	UTSW	5	106847709	missense	probably benign	0.00
R6651:Hfm1	UTSW	5	106847687	missense	probably benign	0.00
R6761:Hfm1	UTSW	5	106895279	missense	probably damaging	1.00
R6835:Hfm1	UTSW	5	106878815	nonsense	probably null
R6891:Hfm1	UTSW	5	106917374	missense	possibly damaging	0.49
R6924:Hfm1	UTSW	5	106850410	splice site	probably null
R6980:Hfm1	UTSW	5	106880477	missense	probably benign	0.31
R7054:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7058:Hfm1	UTSW	5	106911440	missense	probably benign	0.04
R7189:Hfm1	UTSW	5	106901703	critical splice donor site	probably null
R7250:Hfm1	UTSW	5	106904331	missense	probably benign	0.00
R7577:Hfm1	UTSW	5	106896043	missense	probably benign	0.01
R7636:Hfm1	UTSW	5	106917466	missense	probably benign	0.02
R7639:Hfm1	UTSW	5	106889925	missense	probably benign	0.03
R7639:Hfm1	UTSW	5	106898475	missense	possibly damaging	0.46
R7763:Hfm1	UTSW	5	106881861	missense	probably damaging	1.00
R7828:Hfm1	UTSW	5	106881791	critical splice donor site	probably null
R7905:Hfm1	UTSW	5	106898553	missense	probably damaging	1.00
R8160:Hfm1	UTSW	5	106896033	missense	probably null	0.00
R8477:Hfm1	UTSW	5	106881818	missense	probably benign	0.01
R8739:Hfm1	UTSW	5	106898505	missense	probably damaging	0.96
Z1177:Hfm1	UTSW	5	106871820	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ATCCGCAGAGAGCAGCTTAG -3'
(R):5'- AGCAGATATCTTCCCAGGACAATTAAG -3'

Sequencing Primer
(F):5'- GTGTATATATCCCAGCTAGTGAGTC -3'
(R):5'- AGTTATAAGGCTTGGTTATCCCTCAC -3'

Posted On

2019-09-13