Incidental Mutation 'R7376:Vmn1r128'
ID 572390
Institutional Source Beutler Lab
Gene Symbol Vmn1r128
Ensembl Gene ENSMUSG00000095758
Gene Name vomeronasal 1 receptor 128
Synonyms Gm8509
MMRRC Submission 045459-MU
Accession Numbers
Essential gene? Not available question?
Stock # R7376 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 21083298-21084221 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 21083668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 124 (G124V)
Ref Sequence ENSEMBL: ENSMUSP00000129433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169165]
AlphaFold L7N2B4
Predicted Effect probably damaging
Transcript: ENSMUST00000169165
AA Change: G124V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129433
Gene: ENSMUSG00000095758
AA Change: G124V

DomainStartEndE-ValueType
Pfam:TAS2R 8 299 3.6e-16 PFAM
Pfam:7tm_1 31 288 3.8e-6 PFAM
Pfam:V1R 41 296 8.4e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (60/61)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,241,118 (GRCm39) I994V probably benign Het
Acan T G 7: 78,738,055 (GRCm39) probably null Het
Adamts12 G A 15: 11,277,425 (GRCm39) V680I possibly damaging Het
Adgrg7 T C 16: 56,545,342 (GRCm39) I712V probably damaging Het
Adgrl3 A G 5: 81,942,597 (GRCm39) H1477R probably damaging Het
Adgrv1 T A 13: 81,666,245 (GRCm39) D1937V probably damaging Het
Alms1 T C 6: 85,599,088 (GRCm39) S1305P probably benign Het
Banp T A 8: 122,701,236 (GRCm39) M39K probably damaging Het
Bbs10 A G 10: 111,135,111 (GRCm39) T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,795,448 (GRCm39) probably benign Het
Bltp3b G A 10: 89,645,518 (GRCm39) G1197D probably damaging Het
Brinp2 C T 1: 158,078,938 (GRCm39) C295Y probably damaging Het
Card11 C T 5: 140,883,993 (GRCm39) V429I probably benign Het
Cdca3 G A 6: 124,809,538 (GRCm39) R184H probably benign Het
Cep104 A G 4: 154,067,509 (GRCm39) probably null Het
Clspn A G 4: 126,484,430 (GRCm39) K1196R possibly damaging Het
Cntnap5b A G 1: 99,894,994 (GRCm39) T89A possibly damaging Het
Cpne9 A T 6: 113,266,974 (GRCm39) I136L probably damaging Het
Crat T A 2: 30,296,477 (GRCm39) I330F probably damaging Het
Ctbp2 G T 7: 132,615,697 (GRCm39) Q413K possibly damaging Het
D630045J12Rik T C 6: 38,151,238 (GRCm39) E1220G probably damaging Het
Dap A G 15: 31,235,985 (GRCm39) D41G probably damaging Het
Dnah14 A G 1: 181,590,967 (GRCm39) I3287V probably benign Het
Dsp A G 13: 38,356,819 (GRCm39) H233R probably damaging Het
Dst T C 1: 34,231,770 (GRCm39) I3121T probably benign Het
Espnl T G 1: 91,250,036 (GRCm39) L61R probably damaging Het
Evc2 T C 5: 37,527,983 (GRCm39) S331P possibly damaging Het
Gars1 A G 6: 55,050,344 (GRCm39) E535G probably benign Het
Hfm1 A G 5: 107,043,084 (GRCm39) I650T possibly damaging Het
Iyd T A 10: 3,495,690 (GRCm39) I116N probably damaging Het
Kif16b A G 2: 142,553,792 (GRCm39) L1002S probably damaging Het
Kifbp C T 10: 62,394,843 (GRCm39) V600I possibly damaging Het
Lgi1 G A 19: 38,272,468 (GRCm39) G113D probably damaging Het
Lgi2 G A 5: 52,695,604 (GRCm39) R452C probably damaging Het
Man2b2 T G 5: 36,970,722 (GRCm39) N764T probably damaging Het
Mrps18b A G 17: 36,221,587 (GRCm39) I246T probably benign Het
Muc5b A G 7: 141,426,287 (GRCm39) T4795A possibly damaging Het
Mybl2 G A 2: 162,924,513 (GRCm39) G627D possibly damaging Het
Ndufb8 C T 19: 44,543,794 (GRCm39) R16K probably benign Het
Or5k17 A T 16: 58,746,121 (GRCm39) V271E possibly damaging Het
P4htm C T 9: 108,457,991 (GRCm39) V335M probably damaging Het
Pbx3 A G 2: 34,094,889 (GRCm39) I249T probably damaging Het
Plod3 G T 5: 137,019,335 (GRCm39) V360L probably benign Het
Podxl2 C T 6: 88,826,632 (GRCm39) D161N probably benign Het
Polr1b G T 2: 128,960,993 (GRCm39) V651L probably benign Het
Prr14 T C 7: 127,075,749 (GRCm39) S586P probably benign Het
Pum3 C T 19: 27,371,728 (GRCm39) G575D probably benign Het
Rnf157 C A 11: 116,251,192 (GRCm39) A111S probably benign Het
Robo3 A G 9: 37,344,212 (GRCm39) L29P probably damaging Het
Smarca5 T C 8: 81,452,680 (GRCm39) N342S probably damaging Het
Specc1 T A 11: 62,009,078 (GRCm39) I198K probably benign Het
Tmem177 A T 1: 119,837,744 (GRCm39) *312R probably null Het
Tom1l2 A T 11: 60,152,026 (GRCm39) M172K probably benign Het
Tsc22d4 T C 5: 137,756,414 (GRCm39) V3A unknown Het
Vmn1r15 T C 6: 57,235,342 (GRCm39) I70T probably benign Het
Vmn2r60 A G 7: 41,844,631 (GRCm39) T665A probably damaging Het
Vmn2r83 T C 10: 79,314,790 (GRCm39) F346S probably benign Het
Wdr7 T A 18: 63,910,691 (GRCm39) D694E probably damaging Het
Other mutations in Vmn1r128
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Vmn1r128 APN 7 21,084,001 (GRCm39) missense probably benign 0.01
IGL02169:Vmn1r128 APN 7 21,084,163 (GRCm39) missense probably damaging 0.99
IGL02883:Vmn1r128 APN 7 21,083,440 (GRCm39) missense probably benign 0.00
R1740:Vmn1r128 UTSW 7 21,083,869 (GRCm39) missense probably benign 0.00
R2969:Vmn1r128 UTSW 7 21,084,046 (GRCm39) missense probably damaging 1.00
R4583:Vmn1r128 UTSW 7 21,083,644 (GRCm39) missense possibly damaging 0.79
R4867:Vmn1r128 UTSW 7 21,083,939 (GRCm39) missense possibly damaging 0.53
R5266:Vmn1r128 UTSW 7 21,083,328 (GRCm39) missense probably benign 0.14
R5631:Vmn1r128 UTSW 7 21,083,300 (GRCm39) start codon destroyed probably null 1.00
R6267:Vmn1r128 UTSW 7 21,084,221 (GRCm39) makesense probably null
R8351:Vmn1r128 UTSW 7 21,083,597 (GRCm39) missense probably damaging 1.00
R8440:Vmn1r128 UTSW 7 21,083,745 (GRCm39) missense probably benign 0.22
R8773:Vmn1r128 UTSW 7 21,083,922 (GRCm39) missense probably benign 0.41
R8889:Vmn1r128 UTSW 7 21,083,740 (GRCm39) missense possibly damaging 0.61
R9182:Vmn1r128 UTSW 7 21,083,683 (GRCm39) missense possibly damaging 0.72
R9200:Vmn1r128 UTSW 7 21,083,316 (GRCm39) missense possibly damaging 0.89
R9665:Vmn1r128 UTSW 7 21,083,362 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGACAGGTGATTTTAAGCCAC -3'
(R):5'- GCCTACAATGAATCCAGAAGTGG -3'

Sequencing Primer
(F):5'- GCCAATGCCTTGACTCTATTC -3'
(R):5'- GTGGAACAGAACAAGTTGCTTTTAG -3'
Posted On 2019-09-13