Incidental Mutation 'R7376:Acan'
ID572392
Institutional Source Beutler Lab
Gene Symbol Acan
Ensembl Gene ENSMUSG00000030607
Gene Nameaggrecan
SynonymsAgc1, b2b183Clo, Cspg1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7376 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location79053483-79115099 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 79088307 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032835]
Predicted Effect probably null
Transcript: ENSMUST00000032835
SMART Domains Protein: ENSMUSP00000032835
Gene: ENSMUSG00000030607

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 46 135 3.46e-7 SMART
LINK 151 248 1.76e-59 SMART
LINK 252 350 4.13e-65 SMART
LINK 485 582 1.03e-51 SMART
LINK 586 684 9.58e-61 SMART
low complexity region 767 794 N/A INTRINSIC
low complexity region 845 859 N/A INTRINSIC
low complexity region 890 904 N/A INTRINSIC
low complexity region 913 930 N/A INTRINSIC
low complexity region 966 987 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
low complexity region 1484 1495 N/A INTRINSIC
low complexity region 1707 1720 N/A INTRINSIC
low complexity region 1808 1823 N/A INTRINSIC
low complexity region 1904 1915 N/A INTRINSIC
CLECT 1922 2043 2.13e-37 SMART
CCP 2049 2105 9.32e-11 SMART
low complexity region 2118 2130 N/A INTRINSIC
Meta Mutation Damage Score 0.9495 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Spontaneous mutations in this gene lead to dwarfism, cartilage, skeletal and limb anomalies, craniofacial defects, hearing loss and neonatal death due to respiratory failure. Homozygotes for an ENU-induced allele show cardiomyopathy as well as cleft palate, disproportionate dwarfism and brachypodia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,291,118 I994V probably benign Het
Adamts12 G A 15: 11,277,339 V680I possibly damaging Het
Adgrg7 T C 16: 56,724,979 I712V probably damaging Het
Adgrl3 A G 5: 81,794,750 H1477R probably damaging Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Alms1 T C 6: 85,622,106 S1305P probably benign Het
Banp T A 8: 121,974,497 M39K probably damaging Het
Bbs10 A G 10: 111,299,250 T75A probably benign Het
BC028528 CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT 3: 95,888,136 probably benign Het
Brinp2 C T 1: 158,251,368 C295Y probably damaging Het
Card11 C T 5: 140,898,238 V429I probably benign Het
Cdca3 G A 6: 124,832,575 R184H probably benign Het
Cep104 A G 4: 153,983,052 probably null Het
Clspn A G 4: 126,590,637 K1196R possibly damaging Het
Cntnap5b A G 1: 99,967,269 T89A possibly damaging Het
Cpne9 A T 6: 113,290,013 I136L probably damaging Het
Crat T A 2: 30,406,465 I330F probably damaging Het
Ctbp2 G T 7: 133,013,968 Q413K possibly damaging Het
D630045J12Rik T C 6: 38,174,303 E1220G probably damaging Het
Dap A G 15: 31,235,839 D41G probably damaging Het
Dnah14 A G 1: 181,763,402 I3287V probably benign Het
Dsp A G 13: 38,172,843 H233R probably damaging Het
Dst T C 1: 34,192,689 I3121T probably benign Het
Espnl T G 1: 91,322,314 L61R probably damaging Het
Evc2 T C 5: 37,370,639 S331P possibly damaging Het
Gars A G 6: 55,073,359 E535G probably benign Het
Hfm1 A G 5: 106,895,218 I650T possibly damaging Het
Iyd T A 10: 3,545,690 I116N probably damaging Het
Kif16b A G 2: 142,711,872 L1002S probably damaging Het
Kif1bp C T 10: 62,559,064 V600I possibly damaging Het
Lgi1 G A 19: 38,284,020 G113D probably damaging Het
Lgi2 G A 5: 52,538,262 R452C probably damaging Het
Man2b2 T G 5: 36,813,378 N764T probably damaging Het
Mrps18b A G 17: 35,910,695 I246T probably benign Het
Muc5b A G 7: 141,872,550 T4795A possibly damaging Het
Mybl2 G A 2: 163,082,593 G627D possibly damaging Het
Ndufb8 C T 19: 44,555,355 R16K probably benign Het
Olfr181 A T 16: 58,925,758 V271E possibly damaging Het
P4htm C T 9: 108,580,792 V335M probably damaging Het
Pbx3 A G 2: 34,204,877 I249T probably damaging Het
Plod3 G T 5: 136,990,481 V360L probably benign Het
Podxl2 C T 6: 88,849,650 D161N probably benign Het
Polr1b G T 2: 129,119,073 V651L probably benign Het
Prr14 T C 7: 127,476,577 S586P probably benign Het
Pum3 C T 19: 27,394,328 G575D probably benign Het
Rnf157 C A 11: 116,360,366 A111S probably benign Het
Robo3 A G 9: 37,432,916 L29P probably damaging Het
Smarca5 T C 8: 80,726,051 N342S probably damaging Het
Specc1 T A 11: 62,118,252 I198K probably benign Het
Tmem177 A T 1: 119,910,014 *312R probably null Het
Tom1l2 A T 11: 60,261,200 M172K probably benign Het
Tsc22d4 T C 5: 137,758,152 V3A unknown Het
Uhrf1bp1l G A 10: 89,809,656 G1197D probably damaging Het
Vmn1r128 G T 7: 21,349,743 G124V probably damaging Het
Vmn1r15 T C 6: 57,258,357 I70T probably benign Het
Vmn2r60 A G 7: 42,195,207 T665A probably damaging Het
Vmn2r83 T C 10: 79,478,956 F346S probably benign Het
Wdr7 T A 18: 63,777,620 D694E probably damaging Het
Other mutations in Acan
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Acan APN 7 79097824 missense probably benign 0.00
IGL01118:Acan APN 7 79098653 missense possibly damaging 0.78
IGL01145:Acan APN 7 79099282 missense probably damaging 1.00
IGL01308:Acan APN 7 79099249 missense probably damaging 0.98
IGL01520:Acan APN 7 79084570 missense probably damaging 0.96
IGL02069:Acan APN 7 79092752 missense possibly damaging 0.83
IGL02629:Acan APN 7 79111979 missense possibly damaging 0.90
IGL02713:Acan APN 7 79100244 missense possibly damaging 0.90
IGL03001:Acan APN 7 79111294 missense probably damaging 0.99
IGL03081:Acan APN 7 79098543 missense probably benign 0.01
Hollowleg UTSW 7 79098348 nonsense probably null
Sublimate UTSW 7 79111320 missense probably damaging 0.97
Vacuo UTSW 7 79088307 critical splice donor site probably null
IGL03147:Acan UTSW 7 79091056 missense probably damaging 1.00
R0281:Acan UTSW 7 79100285 missense probably damaging 1.00
R0372:Acan UTSW 7 79100601 missense probably benign 0.00
R0599:Acan UTSW 7 79111290 splice site probably benign
R0827:Acan UTSW 7 79099671 missense probably benign 0.00
R0835:Acan UTSW 7 79114232 missense probably damaging 0.96
R1496:Acan UTSW 7 79100804 missense probably benign 0.06
R1716:Acan UTSW 7 79082198 missense unknown
R1761:Acan UTSW 7 79094085 nonsense probably null
R1848:Acan UTSW 7 79099035 missense probably benign
R2002:Acan UTSW 7 79100793 missense probably damaging 1.00
R2025:Acan UTSW 7 79101222 missense probably benign
R2167:Acan UTSW 7 79099957 missense probably benign 0.41
R2189:Acan UTSW 7 79098091 missense probably damaging 1.00
R2303:Acan UTSW 7 79099957 missense probably benign 0.41
R2496:Acan UTSW 7 79111317 missense probably damaging 1.00
R2971:Acan UTSW 7 79099699 missense possibly damaging 0.46
R4004:Acan UTSW 7 79100687 missense probably damaging 1.00
R4669:Acan UTSW 7 79101142 missense probably benign 0.01
R4732:Acan UTSW 7 79098609 missense probably damaging 0.99
R4733:Acan UTSW 7 79098609 missense probably damaging 0.99
R4742:Acan UTSW 7 79100769 missense probably benign 0.41
R4750:Acan UTSW 7 79092718 missense probably damaging 1.00
R5022:Acan UTSW 7 79092808 critical splice donor site probably null
R5122:Acan UTSW 7 79100661 missense probably damaging 0.99
R5190:Acan UTSW 7 79098541 missense probably benign 0.03
R5220:Acan UTSW 7 79088297 missense probably damaging 0.96
R5414:Acan UTSW 7 79100988 missense probably benign 0.00
R5525:Acan UTSW 7 79099983 missense probably benign
R5655:Acan UTSW 7 79100043 missense possibly damaging 0.89
R5662:Acan UTSW 7 79100107 missense possibly damaging 0.78
R5748:Acan UTSW 7 79089699 missense probably damaging 0.98
R5758:Acan UTSW 7 79101214 missense possibly damaging 0.67
R5996:Acan UTSW 7 79111320 missense probably damaging 0.97
R6057:Acan UTSW 7 79099782 missense probably null
R6503:Acan UTSW 7 79097832 missense probably benign 0.04
R6529:Acan UTSW 7 79089731 missense probably benign 0.16
R6887:Acan UTSW 7 79092483 missense probably damaging 1.00
R7041:Acan UTSW 7 79098348 nonsense probably null
R7193:Acan UTSW 7 79086342 missense probably damaging 1.00
R7220:Acan UTSW 7 79108148 missense
R7263:Acan UTSW 7 79092318 missense probably damaging 0.98
R7502:Acan UTSW 7 79094203 missense probably damaging 1.00
R7571:Acan UTSW 7 79086267 missense probably damaging 1.00
R7709:Acan UTSW 7 79089608 missense probably damaging 1.00
R7835:Acan UTSW 7 79099875 missense probably benign 0.08
R8051:Acan UTSW 7 79100779 missense probably damaging 0.96
R8131:Acan UTSW 7 79091338 missense possibly damaging 0.92
R8138:Acan UTSW 7 79098427 missense probably benign 0.12
R8324:Acan UTSW 7 79091056 missense probably damaging 1.00
RF008:Acan UTSW 7 79092400 missense possibly damaging 0.83
Z1088:Acan UTSW 7 79088200 nonsense probably null
Z1088:Acan UTSW 7 79100110 missense probably benign 0.41
Z1088:Acan UTSW 7 79111354 missense probably benign
Z1176:Acan UTSW 7 79111354 missense probably benign
Z1177:Acan UTSW 7 79094170 missense probably damaging 0.96
Z1177:Acan UTSW 7 79100137 missense probably damaging 0.99
Z1177:Acan UTSW 7 79111354 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGAGCAGACTTGGACAG -3'
(R):5'- GAACCCCTTCAAAGTGAATAGC -3'

Sequencing Primer
(F):5'- TGGCTACAAGGACAGTGACTTTG -3'
(R):5'- CATGGATTCCAGCAAGAGACCATTG -3'
Posted On2019-09-13