Mutagenetix > Incidental Mutation

Incidental Mutation 'R7376:Smarca5'

572396

Institutional Source

Beutler Lab

Gene Symbol

Smarca5

Ensembl Gene

ENSMUSG00000031715

Gene Name

SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5

Synonyms

D030040M08Rik, D330027N15Rik, 4933427E24Rik, MommeD4, Snf2h

MMRRC Submission

045459-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7376 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80698507-80739497 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80726051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 342 (N342S)

Ref Sequence

ENSEMBL: ENSMUSP00000044361 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043359]

AlphaFold

Q91ZW3

Predicted Effect

probably damaging
Transcript: ENSMUST00000043359
AA Change: N342S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000044361
Gene: ENSMUSG00000031715
AA Change: N342S

Domain	Start	End	E-Value	Type
low complexity region	2	53	N/A	INTRINSIC
Pfam:DBINO	65	112	1.1e-4	PFAM
low complexity region	145	156	N/A	INTRINSIC
DEXDc	175	367	3.9e-46	SMART
Blast:DEXDc	386	421	6e-11	BLAST
HELICc	512	596	6.2e-28	SMART
low complexity region	756	768	N/A	INTRINSIC
low complexity region	820	837	N/A	INTRINSIC
SANT	840	889	2.3e-7	SMART
SANT	942	1006	3e-7	SMART
low complexity region	1008	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.5584

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The protein encoded by this gene is a component of the chromatin remodeling and spacing factor RSF, a facilitator of the transcription of class II genes by RNA polymerase II. The encoded protein is similar in sequence to the Drosophila ISWI chromatin remodeling protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during early embryonic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	G	11: 9,291,118	I994V	probably benign	Het
Acan	T	G	7: 79,088,307		probably null	Het
Adamts12	G	A	15: 11,277,339	V680I	possibly damaging	Het
Adgrg7	T	C	16: 56,724,979	I712V	probably damaging	Het
Adgrl3	A	G	5: 81,794,750	H1477R	probably damaging	Het
Adgrv1	T	A	13: 81,518,126	D1937V	probably damaging	Het
Alms1	T	C	6: 85,622,106	S1305P	probably benign	Het
Banp	T	A	8: 121,974,497	M39K	probably damaging	Het
Bbs10	A	G	10: 111,299,250	T75A	probably benign	Het
BC028528	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT	3: 95,888,136		probably benign	Het
Brinp2	C	T	1: 158,251,368	C295Y	probably damaging	Het
Card11	C	T	5: 140,898,238	V429I	probably benign	Het
Cdca3	G	A	6: 124,832,575	R184H	probably benign	Het
Cep104	A	G	4: 153,983,052		probably null	Het
Clspn	A	G	4: 126,590,637	K1196R	possibly damaging	Het
Cntnap5b	A	G	1: 99,967,269	T89A	possibly damaging	Het
Cpne9	A	T	6: 113,290,013	I136L	probably damaging	Het
Crat	T	A	2: 30,406,465	I330F	probably damaging	Het
Ctbp2	G	T	7: 133,013,968	Q413K	possibly damaging	Het
D630045J12Rik	T	C	6: 38,174,303	E1220G	probably damaging	Het
Dap	A	G	15: 31,235,839	D41G	probably damaging	Het
Dnah14	A	G	1: 181,763,402	I3287V	probably benign	Het
Dsp	A	G	13: 38,172,843	H233R	probably damaging	Het
Dst	T	C	1: 34,192,689	I3121T	probably benign	Het
Espnl	T	G	1: 91,322,314	L61R	probably damaging	Het
Evc2	T	C	5: 37,370,639	S331P	possibly damaging	Het
Gars	A	G	6: 55,073,359	E535G	probably benign	Het
Hfm1	A	G	5: 106,895,218	I650T	possibly damaging	Het
Iyd	T	A	10: 3,545,690	I116N	probably damaging	Het
Kif16b	A	G	2: 142,711,872	L1002S	probably damaging	Het
Kif1bp	C	T	10: 62,559,064	V600I	possibly damaging	Het
Lgi1	G	A	19: 38,284,020	G113D	probably damaging	Het
Lgi2	G	A	5: 52,538,262	R452C	probably damaging	Het
Man2b2	T	G	5: 36,813,378	N764T	probably damaging	Het
Mrps18b	A	G	17: 35,910,695	I246T	probably benign	Het
Muc5b	A	G	7: 141,872,550	T4795A	possibly damaging	Het
Mybl2	G	A	2: 163,082,593	G627D	possibly damaging	Het
Ndufb8	C	T	19: 44,555,355	R16K	probably benign	Het
Olfr181	A	T	16: 58,925,758	V271E	possibly damaging	Het
P4htm	C	T	9: 108,580,792	V335M	probably damaging	Het
Pbx3	A	G	2: 34,204,877	I249T	probably damaging	Het
Plod3	G	T	5: 136,990,481	V360L	probably benign	Het
Podxl2	C	T	6: 88,849,650	D161N	probably benign	Het
Polr1b	G	T	2: 129,119,073	V651L	probably benign	Het
Prr14	T	C	7: 127,476,577	S586P	probably benign	Het
Pum3	C	T	19: 27,394,328	G575D	probably benign	Het
Rnf157	C	A	11: 116,360,366	A111S	probably benign	Het
Robo3	A	G	9: 37,432,916	L29P	probably damaging	Het
Specc1	T	A	11: 62,118,252	I198K	probably benign	Het
Tmem177	A	T	1: 119,910,014	*312R	probably null	Het
Tom1l2	A	T	11: 60,261,200	M172K	probably benign	Het
Tsc22d4	T	C	5: 137,758,152	V3A	unknown	Het
Uhrf1bp1l	G	A	10: 89,809,656	G1197D	probably damaging	Het
Vmn1r128	G	T	7: 21,349,743	G124V	probably damaging	Het
Vmn1r15	T	C	6: 57,258,357	I70T	probably benign	Het
Vmn2r60	A	G	7: 42,195,207	T665A	probably damaging	Het
Vmn2r83	T	C	10: 79,478,956	F346S	probably benign	Het
Wdr7	T	A	18: 63,777,620	D694E	probably damaging	Het

Other mutations in Smarca5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00323:Smarca5	APN	8	80714041	missense	probably benign	0.10
IGL01138:Smarca5	APN	8	80701076	missense	possibly damaging	0.87
IGL01290:Smarca5	APN	8	80727648	missense	probably benign
IGL02338:Smarca5	APN	8	80719570	splice site	probably benign
IGL03212:Smarca5	APN	8	80711781	missense	possibly damaging	0.47
IGL03216:Smarca5	APN	8	80719658	missense	probably damaging	1.00
Cipher	UTSW	8	80719652	missense	probably damaging	1.00
Codebook	UTSW	8	80733707	missense	probably benign
Codex	UTSW	8	80710563	missense	probably damaging	0.99
Encryption	UTSW	8	80704726	missense	probably damaging	1.00
Enigma	UTSW	8	80705332	missense	probably benign	0.35
Key	UTSW	8	80726051	missense	probably damaging	1.00
Sailor	UTSW	8	80736726	missense	probably benign	0.07
Soldier	UTSW	8	80719715	missense	probably damaging	1.00
tinker	UTSW	8	80733750	missense	probably benign
R0254:Smarca5	UTSW	8	80704700	missense	probably benign	0.05
R0374:Smarca5	UTSW	8	80736731	missense	probably benign	0.30
R0625:Smarca5	UTSW	8	80720686	critical splice donor site	probably null
R1065:Smarca5	UTSW	8	80704714	missense	probably damaging	1.00
R1164:Smarca5	UTSW	8	80710631	missense	probably damaging	1.00
R1709:Smarca5	UTSW	8	80709220	nonsense	probably null
R2102:Smarca5	UTSW	8	80704675	missense	probably damaging	1.00
R3831:Smarca5	UTSW	8	80728494	missense	probably damaging	0.99
R4625:Smarca5	UTSW	8	80710563	missense	probably damaging	0.99
R4750:Smarca5	UTSW	8	80733707	missense	probably benign
R4822:Smarca5	UTSW	8	80708680	splice site	probably null
R4889:Smarca5	UTSW	8	80704697	missense	possibly damaging	0.95
R5756:Smarca5	UTSW	8	80710604	missense	probably benign
R6120:Smarca5	UTSW	8	80711743	missense	probably damaging	0.98
R6582:Smarca5	UTSW	8	80719652	missense	probably damaging	1.00
R6939:Smarca5	UTSW	8	80705320	missense	possibly damaging	0.63
R6972:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R6973:Smarca5	UTSW	8	80704751	missense	probably damaging	1.00
R7027:Smarca5	UTSW	8	80736726	missense	probably benign	0.07
R7514:Smarca5	UTSW	8	80717534	missense	probably damaging	1.00
R7962:Smarca5	UTSW	8	80736759	missense	probably benign
R8031:Smarca5	UTSW	8	80704682	missense	probably damaging	1.00
R8400:Smarca5	UTSW	8	80709127	missense	probably benign	0.02
R8798:Smarca5	UTSW	8	80716508	missense	probably damaging	1.00
R8817:Smarca5	UTSW	8	80733750	missense	probably benign
R8824:Smarca5	UTSW	8	80705332	missense	probably benign	0.35
R8905:Smarca5	UTSW	8	80713948	missense	probably benign	0.14
R9018:Smarca5	UTSW	8	80704726	missense	probably damaging	1.00
R9028:Smarca5	UTSW	8	80714013	missense	probably damaging	1.00
R9203:Smarca5	UTSW	8	80704629	nonsense	probably null
R9253:Smarca5	UTSW	8	80719715	missense	probably damaging	1.00
R9294:Smarca5	UTSW	8	80719803	missense	probably damaging	1.00
R9328:Smarca5	UTSW	8	80720749	missense	probably benign	0.00
R9396:Smarca5	UTSW	8	80736729	missense	probably benign	0.00
R9514:Smarca5	UTSW	8	80702211	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGTTAGTAACTGGCTAGCTACATAAG -3'
(R):5'- ACAGGCTGCATTTGTCAGGG -3'

Sequencing Primer
(F):5'- GGCCATATCAAACAGTGCTA -3'
(R):5'- GTGTGTGTCACATCTTATGAAATGC -3'

Posted On

2019-09-13